The Lords of Ruin -- Battletech/Killzone

[X] Plan: Chrome, Blood and Gold
https://forums.sufficientvelocity.com/threads/the-lords-of-ruin-battletech-killzone.52819/page-1085?post=31697580#post-31697580

---

Hearts of Silicon
[X] No
Despite the initially even split between those who wished to expand recruitment of cybernetically augmented soldiers and those critics who thought the risks outweighed the benefits, the March-April transition saw more and more members of the Gemini government side with the latter in response to the litany of risks presented to them throughout the debate. Confronted with compelling arguments regarding the Republic's ability to scrutinise and police cyborg troopers—one popular example proving a cyborg with a semi-secret drinking problem—it took Helghan's government only a few weeks to settle the matter, the proposal to expand recruitment voted down by a considerable margin by April 12th. Though a disappointing result to many of the project's backers, not least those who invested a great deal of political capital in its success, said backers were able to console themselves with the knowledge that they could always try again in a year or two; mid-April seeing the loose coalition that made up the pro-cyborg side of the debate start laying the groundwork to relitigate the matter even as the Republic's parliament moved on to consider other topics.

Effect

• The Republic votes to keep cyborg troops as they are.
• The pro-cyborg faction gets ready to annoy everyone by litigating the matter sometime down the track

ATGCACCTGTAGTAGCTACTCAGCCTGCTCAGCCATATCTGTTGTTAC
[X] Yes
Intrigued by the Canopian doctors' ideas and with the expansion of cyborg recruitment already denied, if only temporarily, April's first few weeks saw the ruling government immediately turn to debate granting access to Clan POWs. Well aware of the Clan's experience with genetic engineering— in large part thanks to the constant barrage of boasting made by even comparatively sympathetic POWs, but also due to prior interviews with Clan medical personnel—many within the Gemini government proved eager to pounce on the idea of studying the long-term effects of genetic manipulation; the thought of Helghan's populace benefiting from the knowledge unstated, but well understood by all involved. A powerful and influential bloc, this group was nonetheless opposed by those who, while accepting of the potential benefits, believed that permitting the Canopians access would represent an unacceptable risk to their safety and the overall security of the Cassildan facility. Not unsympathetic to their concerns, it took only a short time before the two blocs devised a compromise solution—the Republic informing Canopus that its scientists were welcome to carry out their study and retrieve whatever samples desired, so long as they followed a list of simple security procedures and obeyed all directions by camp personnel.

As hungry for the data as Helghan was, the Canopians agreed to the rather understandable terms without a quibble; their scientists soon dispatched to Cassilda aboard a fast cutter.

Effect

• Republic agrees to allow Canopian scientists access to the Cassildan POWs with reasonable caveats.
• Long term, maybe something useful will come of it.

---

[X] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalize on the effort and expand the Republic's reach.
"Lark calling Nest. Repeat: Lark calling Nest. Skies are clear; no hawks in sight. Resuming activity." - Codename LARK renewing contact.

With the situation in the former Outback growing more concerning with every passing day, evidence suggesting FedSun involvement in said worsening situation, and reports from the Suns' interior describing a growing right-wing movement among politicians and the common folk, Helghan's government found its attention turned away from the Clan Invasion just long enough to divert additional resources towards infiltrating its coreward rival; orders cut within days of the second quarter's start. Trained in the ins and outs of the Suns' culture and with substantial aid provided by extant networks of agents and their assets, the April-June period saw well over a dozen Republic operatives slip over the border and into the Federated Suns proper, fabricated histories providing them with a near unquestionable right to be there and untraceable C-Bills covering the rest. Arriving in the nation without a ripple of alarm, these agents quietly manoeuvred themselves into position to take over those roles left vacant by better-established agents as they rose to more sensitive roles within the Suns' government, and the interstellar-scale shell game saw Republic intelligence organs expand their reach substantially by the time June came to a close.

Effect

• Success
• Infiltration raises a step, giving you access to additional information and actions.

[X] Deepen penetration into Neo-Jacobin circles, find proof of their collusion with the Federated Suns or otherwise gather intelligence on their actions in the URC.
In total contrast to the Republic's successes in the Federated Suns, Helghan efforts to infiltrate the Neo-Jacobins met with complete failure despite the pressing need to confirm the recent determination of FedSun involvement in Jacobin politics and the substantial resources put to that end. Successfully crossing the border into URC space and arriving on Jacobin-held planets with significant assistance from the region's disunity and political gridlock, Helghan agents reported green lights on all their infiltration efforts and quickly received the go-ahead to penetrate deeper into the Jacobins' organisational structure, the ultimate goal being to gain hard evidence of FedSun involvement with the movement's higher-ups. Unfortunately for the Republic, though its agents' reports were initially encouraging—the time spent studying the movement's vast corpus of works proving well worth the effort—satisfaction in their success soon turned to alarm when the stream of reports ceased almost overnight and the Republic's agents vanished from sight.

Undoubtedly the result of counter-intelligence activities, the sudden disappearance and presumed capture of multiple Helghan spies prompted a flurry of activity within the Gemini government the moment the news arrived, a dozen plans drawn up to disavow any claims by the Jacobins even as arguments raged as to who detected the Republic's spies and how; several figures arguing that the Jacobins got lucky—or the Republic got complacent—while others have argued that they received assistance from the Federated Suns. Regardless of exactly how the situation occurred, all within the Republic's intelligence services and government have been left waiting for the other shoe to drop.

Effect

• Attempt to infiltrate the Neo-Jacobins fails badly with a handful of spies captured, though presumably still alive given the value of captured spies.
• The Jacobins have yet to say anything about the spies.

[X] Commit Security Forces: Once the responsibility of those the Republic has since ousted/bribed to leave, the former Trinity League is bereft of security forces. Temporarily deploying Helghan security forces, while only a stopgap, will almost certainly help local police keep a handle on things. [Progress: 2/3]
"On Jia Tian, the cooks are Capellan, the police are Helghan, the mechanics are Taurian, the lovers are Canopian, and the drivers are Aurigan…" - Anonymous, circa 3050s

Continuing from earlier efforts, 3050's second quarter saw Republic security personnel redouble their efforts to assume control of security roles throughout the former Trinity League, each passing day seeing fewer and fewer responsibilities left in the hands of the local police by local governments eager to transfer them into the Republic's purview. Vastly more visible than the region's previous secret police forces and held to higher than usual levels of accountability thanks to perception-conscious superiors concerned about touching raw nerves, the sterling reputation of Helghan security personnel maintained its lustre among the region's people despite the Republic all but completely supplanting local police as the primary provider of security; the sight of Helghan police commonplace by June's opening. To the relief of those overseeing the program—and as something of a surprise under the circumstances—far from resenting this replacement, the police forces so affected proved almost deliriously grateful for the opportunity to recuse themselves from the task; the police finally able to rebuild from the grievous structural wounds suffered during and after Operation Telemachus.

[Progress: 2/3] → [Progress: 3/3]

Effect

• Helghan security forces finish taking over most security roles.
• Local police are now in the process of rebuilding and will no doubt be easy to influence.

[X] Commit to, and convince ORDI and Rasalhague planners to contribute toward, an increase in strategic depth to the situation in the FRR, and construct a forward production point on an appropriate world within the region where arms and munitions can be transferred from factory to Initiative soldier at best speed. There is no guarantee the situation in the Commonwealth won't deteriorate or that the Wolves won't make further gains in the future.
"We cannot outfight the Clans unless, at the same time, we outproduce them locally. It is not enough to transport just a few more bombs, a few more bullets, a few more guns, or a few more parts than can be brought to bear by our enemies. We must produce them in the Free Republic so overwhelmingly that there can be no question of our ability to provide a crushing superiority of equipment in any theatre in the Clan Invasion. To that end, our government has reached out to Elected Prince Magnusson and secured the cooperation of his nation in this endeavour." - Prime Minister Gemini Malkiewicz, speech to parliament, 02/04/3050.

Wary of the proximity of Clan forces to forward production sites such as Fort Loudon and with the Free Rasalahague Republic suffering from a distinct paucity of industrial capacity due to earlier losses, Q2 3050 saw several notable figures within the Republic military push for the construction of much-needed factories within the Free Republic; their proposal soon adopted by the Gemini government within weeks of being raised. Quickly realising that the initial proposal of something on the scale of Tsitsang would be almost impossible to achieve even in peacetime, the Gemini government soon pared the idea back to its bare essentials, round after round of investigation and revision reducing the proposal to a much more reasonable but still ambitious plan to construct a supplementary Fort Loudon-esque factory on a world deep behind the Gunzburg line. A workable idea now in mind, mid-April saw the Republic's government pass on the idea to the Rasalhagian Riksdag via HPG—ComStar once more proving its worth by providing priority routing to both sides—as well as with its allies in the ORDI.

Eternally hungry for support against the invading Clans, spending vast amounts of weapons and ammunition on raising additional regiments, and with the Republic having earned a great deal of goodwill thanks to its actions, the Riksdag itself proved more than happy to back the idea of an ORDI built support factory; the Coreward parliament offering to site the factory on Lothan, though unable to provide meaningful support to assist in its construction. Meanwhile, the Republic's allies in the Outer Rim Defence Initiative were rather more hesitant to support the idea, all five member-states quietly sharing reservations regarding the sheer amount of resources such a construction/upgrade effort would absorb and the impact it would have on Operation Santiago's ability to conduct offensive operations. However, despite these initial doubts, a shock and awe campaign by Helghan diplomats that ran until the end of the quarter combined with the sheer goodwill earned by the Republic's industry over the past decade saw all five eventually come around to the idea—though only the Capellan Confederation proved to be in any position to materially support construction.

Effect

• Takes a whole quarter, but they agree. Rasalhague agrees to site it on Lothan but expects it'll be hellaciously expensive to produce.
• Work begins next turn on the Lothan factory complex (0/10 Progress with the CapCon providing +1AP and multiple choices available to trade Ground and Space supply cap for progress)

[X] Establish Battle Armour Production: Requiring many specialist components and manufacturing processes to construct and support, the deployment of battle armour to Republic units will require the creation of dedicated manufacturing centres and logistics pathways before it is practically feasible on any scale.
"How much fucking shit is there on the menu, and what fucking flavour is it?" - Melissa Ketill, Quality Control Lead, Mount Koshtan-Tau Battle Armor Plant, Day Seven.

Following the recent perfection of battle armour by Capellan scientists and the technology's subsequent sharing with the rest of the Outer Rim Defence Initiative, Q2 3050 saw the Gemini government beset from all sides with demands for the ultra-heavy powered suits; the need for a counter to the Clans' infamous Fleas lending the calls an edge keenly felt by all. Well aware that the Republic's existing power armour designs—having already earned the designation Power Armour (Light) in the face of the Clan Invasion—were imperfect solutions to the problem posed by the Clans' heavily armoured infantry, Prime Minister Malkiewicz and the rest of their party quickly found the pressure almost irresistible, the Republic parliament passing an emergency funding measure within weeks of April's start and ordering the construction of manufacturing centres and supply lines for the highly advanced suits. Fueled by the many millions of Marks and backed up by supreme political interest, construction of the manufacturing plants began almost the same day the funding bill was signed, with work on feeder factories and their feeder factories following soon after.

Absorbing a notable fraction of the planet Helghan's industrial output for three months, the wartime task progressed both impossibly swiftly and agonisingly slowly in the minds of Republic politicians, the need for the armour growing with every Helghan body that returned from the frontline. However, seemingly answering the increasingly strident calls for an answer to the Clans' battle armour, June saw work finish on the planned battle armour production facilities, the small-batch facilities coming online as the month's end rapidly approached, and starting test runs for quality assurance. Unfortunately for those who hoped for an immediate ramp-up to full-scale production, these same test runs soon revealed substantial flaws in several of the new manufacturing processes introduced in the construction of battle armour—everything from unreliable electronics to warped structural components and brittle armour plates afflicting the production lines.

Arriving at the end of the quarter with a number of manufacturing centres suffering production issues ranging from the irritating to the outright dangerous and an ever-intensifying war to galactic north, the Republic's leaders found an uncomfortable decision lying ahead of them.

Effect

• Process to establish production sites goes well, but the test runs reveal an unexpectedly high number of components suffering from manufacturing flaws.
• Choice next turn about what to do about it.

[X] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessel's to Clan-held regions will improve the ORDI's ability to gather information substantially.
Much to the relief of those involved in the decision-making behind the flawed establishment of battle armour manufacturing in the Helghan Republic, Helghan efforts to disperse spy ships throughout Clan-controlled space achieved quietly successful results; thirteen Hyde-Class vessels travelling to Rasalhagian space via the ORDI Command Circuit before making their way to an equal number of Clan-held systems.

Constructed in top secret shipyards across Helghan and filled to bursting with sensor and computing systems able to spin gold from the merest scraps of data, the eight thousand-ton vessels boasted some of the most advanced automation and communication technology ever devised by Helghan scientists, as well as the smallest warp drive in existence and a crew of sixty drilled in the ins and outs of civilian trade practices. Intentionally designed to resemble the Republic's Jekyll-Class Warp Courier—or rather, with the Republic's Jekyll-Class Warp Courier intentionally designed to resemble the Hyde-Class Surveillance Vessel—the thirteen Hyde-class vessels jumped into the outer reaches of their target systems before slow-boating into position on minimal thrust, the crews' cautious approach and the thick layer of stealth paint applied to the vessels for this deployment rewarded by an absolute dearth of alarm from occupying forces.

Arriving without incident at their chosen deployment zones a mere month after warping into their respective systems, the cluster of spy ships deployed their sensors without undue haste and drank deep from the wealth of data radiating out from the inner system; receivers in Operation Santiago's headquarters soon chattering to life with coded messages...

Effect

• Deployment goes very well with a dozen spy ships deployed throughout Clan-occupied space and transmitting data back. No indication that the Clans are aware of them.

[X] Operation Santiago Phase 6 Objectives
-[X] Deploy the Pilum Battlecruiser awaiting orders at Tsitsang along with accompanying shielded Commissars, to serve as a Flag Vessel for the operation. Deploy the other half of Fourth Division to the front, an additional MAWLR-II and one additional Battlemech regiment.
-[X] Keep pressing the Wolves, securing worlds at military planners on the front's discretion in accordance with the previous strategy of our goal to secure the FRR-LC border worlds currently held by Clan Wolf from Rasalgethi to Laurent, running as far west as Benfled.
Eager to continue the already successful counter-attack against the invading wolves, the April-June period saw Operation Santiago's leadership ramp up attacks against the invaders—Domain, Suk, and La Grave all targeted for assault by leading elements of the ORDI assault. Setting forth with overwhelming numbers and equally overwhelming firepower, including several warships and multiple garrison troops from the Free Republic, these forces crashed down upon their enemy with little warning and equally little mercy; the skies of all three worlds soon filled with streaking fireballs as ORDI units made landfall and engaged their enemy. Though far from inclined to surrender, it took a little over a week for the Outer Rim Defence Initiative to crush the wolf presence on Domain and Suk, dogged resistance no match for the sheer amount of force arrayed against them and both worlds liberated by the time April drew to a close. On La Grave, the wolves faired a little better, with clever tactics and grim determination allowing the 341st Assault Cluster to make true the system's name for many of the liberators, though ultimately falling under ORDI guns just the same.

Surging past these apocalyptic struggles, other elements of the counter-attack struck out against Rastaban, Montmarault, Shaula, and Benfled, reinforcements from the Helghan Republic and its allies joining them mere days from combat. As in the prior quarter, the wolf defence of these systems shattered almost immediately under the forces arrayed against them; only those warriors in the 3rd Battle Cluster able to put up notable resistance. Engaging ORDI forces attacking Montmarault with unrelenting aggression from before they landed until the conclusion of the invasion, the 3rd Battle Cluster under the command of Star Captain Warwick proved its boasts more than braggadocio, the mere act of defeating them proving comparatively painful considering the resources deployed against them. Nonetheless, mid-June saw the quartet of systems fall under ORDI control, the savaging of the Wolves on Benfled by the Black Widow Battalion seeing the mercenary unit gain a substantial supply of Clan technology and prisoners thanks to the rules of Zellbrigen.

Concurrently with the twin assault, the April-June period saw Commodore Ostergaard order a series of deep penetration raids against the Clans' supply convoys heading to and from the frontlines. Though negatively impacted by the number of warships seconded to Plan Cascade—the ORDI's attempt to force a decisive battle with Clan Snow Raven's Blackwater navy— and the defensive needs of the counter-attack, the addition of Hyde-class Surveillance Vessels to the list of intelligence-gathering assets in the region allowed the assembled strike forces to maximise the damage dealt. Launching before the first strike landed on Domain, the ORDI warships ran roughshod over several Clan supply convoys for several months; a Wolf Vincent Mk. 42. destroyed outright, and a Coyote Liberator fleeing after sustaining heavy damage.

Effect

• Reinforcements come in
• Suk, Domain, La Grave, Rastaban, and Montmarault are all captured, albeit with heavy losses due to the ferocious resistance.
• Wolf Dragoons take Shaula and Benfled with ORDI support, capturing even more clan gear for themselves.
• Convoy raiding goes very well. One warship destroyed, one forced to flee after taking heavy damage.

[X] Navy is to utilize intelligence from deployed satellites and spy ships and, if possible, to either goad or force Snow Raven into committing to battle, destroying Snow Raven or other Clanner naval assets in the region which present themselves as targets of opportunity. If possible, request the Draconis Combine to allow vessels posted there to coordinate with this effort.
"FLASH MESSAGE: HNS AURORA TO SANTCOM

DOG WON'T HUNT. REPEAT. DOG WON'T HUNT. MOVING TO SECONDARIES." - Captain Daniel Isakov, HNS Aurora, report to Commodore Ostergaard, 23/06/3050

Not content with only continuing the assault against Clan Wolf holdings in the Inner Sphere, 3050's second quarter saw Commodore Ostergaard and the rest of the man's staff enact plans for a major naval operation against the Snow Raven's Blackwater assets, April's first week seeing dozens of senior officers and hundreds of analysts brought together to devise what soon became Plan Cascade. Relatively simple in concept, Cascade's first goal was to identify vital Snow Raven resources that the Clan must defend with warships, the ORDI subsequently jumping any such defenders with overwhelming force. Intended as a knockout blow against the Snow Raven's naval capacity and their store of warship-grade Petrusite weaponry, Plan Cascade's success would also permit ORDI warships freedom of action against the eugenicist invaders and greatly hasten the conclusion of the invasion.

With the Plan Cascade conceived, developed, and perfected by early June, the days following saw Commodore Ostergaard approve its launch, the vast wheels of military bureaucracy slowly grinding to life to send orders and communiqués all across the Coreward Inner Sphere even as the counterattack against the wolves continued.

Unfortunately for the Republic, the first sign that Plan Cascade would prove less than successful occurred when the Draconis Combine politely declined to allow the quartet of Nocti operating in the nation to be removed from patrol duty. Returned from the highest levels of the Combine's government with all the politeness and dissembling such a thing entails, the Combine's reply acknowledged Cascade's potential value in evening the playing field but pointed to the likelihood of a resumed Clan offensive as to the reasons behind their answer. Lacking any warships of their own and facing off against multiple Clans simultaneously, the Combine would naturally suffer if the Clan Invasion were to resume in earnest and the warships were out of position. Irritated by this response but unwilling to push the Combine lest the recently elevated Coordinator find himself forced to do something rash, Commodore Ostergaard ordered the matter closed, the attention of those involved in Plan Cascade turning towards identifying a target so valuable the Snow Ravens would be forced to defend it.

However, once again, fortune turned its gaze from the ORDI.

Despite having left numerous stay-behind troops on ORDI worlds, despite the assistance of Rasalhagian spies, and despite the observation satellites and Hyde-class Surveillance Vessels deployed to gather intelligence on Clan activities in the region, ORDI analysts found themselves singularly unable to identify a target of such surpassing value that Clan Snow Raven would have to defend it with warships. Working feverishly as the weeks dragged on and the cutoff date to launch the attack approached, ORDI analysts poured over terabytes of data in vain as they struggled to identify a target that was both extremely valuable and in a position to be hit by warships. Unfortunately for the ORDI, the sole product of their work proved to be an above-average-sized convoy—presumably containing reinforcements or spare parts from the Clans' homeworlds—spotted en route to the frontlines.

Already suspecting that he knew what the Snow Raven's response would be, Commodore Ostergaard nonetheless approved the attack against the convoy, a pair of Nocti catching the vessels in the last leg of their journey and blasting apart many of them with impunity, Snow Raven warships nowhere to be seen.

Effect

• Combine politely but firmly ask the ORDI not to pull away the warships guarding its world. ORDI agrees to leave it be.
• Spy resources fail to identify a particularly vulnerable target, ORDI instead goes for a bigger than usual convoy.
• Snow Ravens refuse to take the bait.

---

Design and Requisition
[X] HSA-49 'Skandia' Gauss-Powered HMG: Both named in celebration of the (in)famous victory on Skandia during Clan Invasion, and as a sign of respect for the personal bravery in the face of near certain death of Clan Smoke Jaguar's warriors, the Skandia Gauss HMG was released for mass production and distribution to both the Republic's regular armies and National Guard units. Designed by Helghan State Arms initially as a crew-served weapon, even with PAL, a tripod mount would have been required to achieve firing stability. However, with the creation of the Republic's first native BA designs, tests have shown that the weapon can be hip or shoulder-fired by Battle Armor as well.

[X] Antigravity Mounts and Gun Carriages: Ranging from anything between simple antigravity hover platforms with rudimentary targeting instruments, to fully automated mobile turret systems with remote control features, this ancient pre-spaceflight Terra concept allows infantry to operate battlemech and vehicle-scale weapon systems without having to rely on said war machines. While nothing revolutionary or particularly advantageous for the Republic, it does still provide both the Regulars and National Guard an additional, albeit last-ditch, defense option. For the Free Rasalhague Republic, however, this development will allow ORDI to furbish the Kungsarme with portable mech-scale weapon systems operable even by basic infantry. These platforms will allow both power-armored and regular troops to redeploy or transport impromptu field guns and heavy weaponry with relative ease and in quick fashion, whether in advance, or in retreat, or even being slotted into prepared, defensive positions and ambush points. More sophisticated variants, such as long-ranged autocannon can even be slaved to nearby targeting systems or even allied vehicles and mechs to coordinate attacks. While also feasible, energy weapons are noted to require extreme care, or even power armor, to use, as the generated heat can only be managed by venting, measures required to achieve firing stability. However, with the creation of the Republic's first native BA designs, tests have shown that the weapon can be hip or shoulder-fired by Battle Armor as well.

[X] Javelin 1H Suicide Drones: Blatantly copying, and then iterating and improving, upon the concept recently introduced by the Federated Suns, the Javelin 1H anti-gravity drone is capable of being fired from a shoulder-mounted launcher or from slaved firing apparatuses mounted to CVs or hardpoints using systems integrated with either the vehicle, mech, and power armor, or a more rudimentary control system. The key difference is variable warheads as with many Helghan munition designs, the crowning loadout being one of Petrusite, seeking out enemy vulnerabilities for a devastating blast to their internals. Aside from more mundane qualitative improvements, it's likely to serve as an ironic reminder of what it's like to have your technology copied out from under you.

---

News and rumours
Helghan
As with last quarter, June 3050 saw the arrival rates of refugees to the Periphery increase slightly; well over 1 million additional people arriving in ORDI systems compared to the same time three months ago. Handled by a well-funded ORDIHCR, these refugees joined those already waiting for entry into one of the alliance's five member-states; food, clothing, housing, and more awaiting them in specifically prepared refugee camps.

Predicted Refugee Acceptance Breakdown For 3050 (+-5%)
Helghan Republic: 26,100,000
Aurigan Coalition: 2,050,000
Capellan Confederation: 11,800,000
Magistracy of Canopus: 5,200,000
Taurian Concordat: 3,400,000

To the rather pleasant surprise of the Helghan government and its military police alike, the year's second quarter saw a small but substantial number of Clan POWs agree to help Canopus' geneticists with their inquiries; biological samples flowing from Cassilda's POW camps in remarkable quantities within weeks of their arrival. Stored in specially made transport canisters and shipped back to Luxen for study with top-of-the-line medical equipment, analysis of the blood and tissue samples carried out over the quarter has already prompted a buzz of excitement from Canopus' medical establishment. Keeping their cards close to their chest, reports shared by Canopus nonetheless state that the genomes of those warriors willing to cooperate show signs of extensive genetic modification compared to those of an ordinary human being. While the nature and number of these modifications have yet to be determined—and will no doubt require a time-consuming sequencing of the Warrior caste's genome and a comparison with that of Inner Sphere humans—experts in the field of genetics have grown more and more excited about the topic as the days passed.


Aurigan Coalition
As with past quarters, Q2 3050 saw the Aurgigan navy welcome nine more Halcon class Destroyers into its ranks, the additional destroyers raising the Coalition's total warship count to thirty-four. A substantial force for any nation, the nation's contingent of warships also represents a major investment of time, money, and industry, so much so that the Coalition has reportedly ceased construction on further warships. In place of purely military vessels, the Arano government has declared that it will instead turn its slipways towards the construction of civilian and dual-purpose designs, the first such design presented to the Helghan Republic and its allies being a long-range exploration vessel inspired by the Markham's Marauder's Argo-class dropship.

Named after the ancient exploration craft used by Polynesian explorers during Terra's pre-spaceflight history, the Wa'a Kaulua class is a purpose-built long-range exploration vessel intended to expand the bounds of human knowledge by hundreds if not thousands of light-years. Massing 200,000 tons, equipped with a compact KF drive, and bearing numerous onboard manufacturing and maintenance facilities, the Wa'a Kaulua class takes advantage of every ancient and modern technology in the Aurigan Coalition's arsenal to deliver a vessel able to venture deep into the galaxy. Boasting enough supplies and life support capacity to support its crew for two years before tapping into its cavernous cargo bays, the Wa'a Kaulua class also comes equipped with four docking collars, expansive vehicle and mech bays, and multiple small craft bays.



Capellan Confederation
Shocking no one, Q2 3050 saw the Capellan navy double in size thanks to the launch of ten Carson II class frigates, the Capellan Warships immediately undergoing trial cruises up and down the length of the Inner Sphere nation in preparation for use against the Clans. Formed into ten squadrons of two mutually supporting vessels each, the rapidly expanding Capellan Navy is reportedly training officers and crew as quickly as it can in preparation for the launch of additional 500-kiloton and 1-megaton hulls; the Confederation intent on making the former the anvil of their fleet while the latter serves as the hammer. In support of this goal, the Capellans have also ceased work on 500,000-ton capacity slipways in favour of more 1,000,000-ton orbital slipways, two such slipways planned to open by the end of the year and another two in 3051.


In something of a surprise to its allies in the Outer Rim Defence Initiative, early June saw the Capellan Confederation unveil a new unit of cybernetically enhanced soldiers to its fellow alliance members, the battalion-strong force related to and subordinated under the Confederation's infamous Death Commandos. Well aware of the Republic's successes against the Federated Suns with its own Cyborgs, it came as no surprise when said unveiling revealed that most of the Confederation's cyborgs bore relatively low-key implants and augmentations; the seeming purpose of the unit to infiltrate hostile nations and prove... difficult. On par with the Helghan Republic and Magistracy of Canopus' cyborg units in terms of individual capabilities, though not in overall size or maturity, the Capellan force has already made impressive showings in training against non-cyborg OpFor, and many expect to see it deployed to the Rasalhaugian front shortly.


Magistracy of Canopus
In similar news to the Aurigan Coalition and the Capellan Confederation, late June saw the launch of three Canopus class frigates by Magistracy shipyards, the trio of vessels bringing the total number of warships in the Canopian fleet to fifteen. Home to the second-smallest navy in the Outer Rim Defence Initiative, the Canopians appear happy enough with their production rate; reports sourced from news services and passive monitoring suggest no change in their rate of shipbuilding or shipbuilding capacity.


Taurian Concordat
Shocking no one, the same period saw the Taurian Concordat launch a number of vessels—a total of two Vanguard-class Destroyers and six Auroch-class Frigates slipping free of their moorings in mid-June. Immediately joining their sibling craft in shakedown cruises and anti-piracy patrols, the eight vessels represent a small but potent increase in the lethality of the Taurian navy and will no doubt serve with the same distinction as those that have come before them. In the same period, the Taurian Concordat not only announced the completion of upgrades to three of its five 200,000-ton capacity slipways, the shipbuilding facilities improved and expanded such that they can now handle work on larger and much heavier Frigates, but also completed work on three new 500-kt slipways, the total number of 500-kt slipways in the Concordat at an impressive 12 by June's end.


However, much to the growing concern of figures within the Helghan Republic, despite the Calderon government trumpeting its naval successes throughout its territory, some Taurian citizens have begun to critique the sheer scale of the expenditure involved—planetary and warpcomm networks abuzz with estimated construction and maintenance costs. Though much of this critique has remained isolated to the recently absorbed territories of the former Federated Suns—and understandably so, given the as-yet-unresolved issues of rights and services in the region—each passing day has seen criticism grow more and more strident and spread further and further, already some of the more fringe commentators in the Concordat's heartland raising the matter on their platforms. How this critique will impact Taurian shipbuilding efforts remains to be seen, but Helghan analysts have warned their superiors to monitor the situation closely.


United Rimward Collective
Much to the surprise of the Republic's ruling government, early July saw Neo-Jacobinist groups within the URC reach out to the Outer Rim Defence Initiative to inform the alliance that they had recently captured several spies attempting to infiltrate their ranks and ask if the ORDI wanted to take charge of them. According to the message sent by the Neo-Jacobinists, they initially believed the spies belonged to rival groups within the URC before eventually concluding they were spies from an as-yet-undetermined Inner Sphere state due to several quirks noticed over long-term observation after their capture that suggested an out-of-region origin. Ordinarily, something the Republic would be overjoyed to hear, doubly so since the Jacobinists are offering to hand the spies over to the ORDI, the matter has been complicated by accompanying images which have revealed the spies to be the same ones the Republic failed to insert into the region over the quarter.

While any embarrassment suffered by the Republic in the eyes of its allies is likely to be both temporary and harmless should it be forced to inform them of the spies' true origins, many within the Republic's intelligence community have been baffled by the Jacobinists actions; some suggesting that they truly don't know who the spies belong to, and other suggesting they know exactly who was attempting to spy on them and are trying to make a point by informing the ORDI as a whole that they captured them. Regardless of what exactly the Neo-Jacobinists hoped to achieve by informing the ORDI about the spies' existence and capture, the Republic's government has a decision to make over the coming days.

Effect

• Choice next turn

Federation of Autonomous Systems
To the great satisfaction of the nation's citizens, Q2 3050 saw the Federation of Autonomous Systems succeed in capturing those former officials involved in the earlier corruption scandal; both the money they stole and the officials themselves recovered in a sweeping series of sting operations. Made possible through ComStar's cooperation—itself bought by Helghan's deal with the quasi-religious organisation—the sting operations saw the criminals arrive at ComStar HPG compounds to clear up supposed issues with their accounts, only to find themselves detained by ComStar guards and handed over to FAS police. Already on their way to the Federation, the criminals will be prosecuted to the fullest extent of the law upon their arrival in August and, hopefully, found guilty of many criminal offences.


ComStar
To the quiet surprise of Helghan's government, the April-June period saw a series of reports indicating the continued withdrawal of security forces from ComStar's HPG compounds in the Inner Sphere, a hundred separate tributaries gradually forming a gargantuan river bounded for Terra. No doubt intending to defend humanity's homeworld and its surrounding systems from the Clans should they break through Coreward states, the recalled troops will almost certainly undergo an intense training program upon their arrival. While the initial reactions of government ministers to the news were quite positive, subsequent comments by Republic military leaders and reports provided by Helghan analysts quickly dimmed hopes that this force might prove meaningful in the Clan Invasion, both groups agreeing that no training program would be enough to forge ComStar's security personnel into a capable fighting force in the time available unless the organisation has been hiding a military program this entire time.


Clan Invasion (Varied)
In recent news from the Lyran Commonwealth, it appears that reports of injuries and deaths among the Kell Hands were not exaggerated; Morgan Kell—famed MechWarrior, cofounder of the Kell Hounds, and brother to Patrick Kell—and many other mercenaries were killed in an engagement with Clan Coyote last quarter. With details having finally made their way through the galaxy via rumour mills and ComStar's News Service, the story of how Morgan Kell brought an entire Clan assault force to a standstill via cunning use of Zelbringen has become almost mythical in the minds of MechFans the galaxy over. Although the exact details of the story change with each retelling, the version compiled by Helghan analysts describes how Morgan Kell, isolated and alone after ordering his lance to regroup with forces under his brother's command, fought a desperate rearguard action against a Clan counter-attack barreling down on the Kell Hounds' staging grounds; the man challenging the Clanners to a series of one-on-one duels for control of the narrow passage leading to the staging area.

Forced by their rules and culture to humour the man, the Coyotes bid among themselves for the honour of duelling him, with the first one stepping forward within moments. Minutes later, as the slain MechWarrior's mech toppled to the ground, Morgan Kell repeated his challenge, and another MechWarrior stepped forward. Again and again, the pattern repeated itself as—using everything from missiles to lasers to bare fists—Morgan Kell slew warrior after warrior until after a star and a half worth of Coyotes lay dead or dying at his feet. Barely able to move his Archer, its armour shattered and myomer internals smouldering, Morgan Kell supposedly made one last challenge to the Coyote force and was, in turn, slain with a single shot to the cockpit.


Federated Suns
Coming as something of a surprise to those in the Republic intelligence community involved in the matter, attempts to tie the Federated Suns to the Neo-Jacobinists have drawn a collective blank; operatives and catspaws within the Federated Suns' intelligence agencies proving unable to find any hard evidence suggesting that there are links between the two groups. An extremely curious outcome considering recent reports from analysts studying the Neo-Jacobinists, explanations for the lack of evidence run the gamut of said interactions being run off the books to the entire body of "evidence" being tainted by expectation bias. However, almost as if only to complicate matters, the same spies responsible for failing to uncover ties between the Federated Suns and the Neo-Jacobinists have also reported that the Security Office of the First Prince has had its budget, powers, and responsibilities expanded dramatically in the time since the Outback intervention; several secretive measures passed to transform it into a small but potent intelligence agency answerable only to the First Prince himself.


Somewhat less comforting, 3050's second quarter saw the Federated Suns' navy continue to expand, four more Reynard-Class and two more Chevalier-class vessels joining the ranks of that once decrepit fleet. Bringing the total number of warships in the Federated Suns to eighteen, the half-dozen new vessels represent a sizable increase in capability and lethality for the nation, rendering it the largest and most powerful navy among the Four Great Houses. Worse still, the same period also saw the Federated Suns complete work on shipyards on the planets Markesan and New Avalon, the new 500,000-ton capacity slipways doubling the Suns' ability to construct frigates. Though unable to compete with any individual ORDI nation, those who study such things have suggested that the Federated Suns' dedication to naval construction speaks to a deep-seated desire to avoid a repeat of the Outback Intervention—a more capable fleet armed with powerful weapons something that would greatly diminish the ORDI's advantages in space and on the ground.


Free Worlds League
Late to get into the game but no less eager to perform, June 3050 saw Free Worlds League workers double the number of 500,000-ton capacity slipways in the League, four new slipways joining the four already present within the nation's industrial core. No doubt terrified of the Outer Rim Defence Initiative's naval might, understandably so considering just how potent it is, Republic analysts believe that the League will pursue an aggressive shipbuilding program in the coming years, messages from Helghan spies detailing frantic activity occurring within all eight slipways. While such estimates are naturally hazy, analysis of League industrial capabilities combined with historical reports suggest that the first batch of warships from League shipyards will likely launch in September of this year.

Lyran Commonwealth
In similar news, ORDI spies operating within the Lyran Commonwealth have reported the completion of another four 500,000-ton slipways by Lyran workers, their frantic labour rewarded with generous bonuses and, apparently, more work. Driven to such heights of effort by the rapidly approaching Clans and their potent warship fleets, the same period saw four more Thor-class frigates join the Lyran navy, their hasty shakedown cruises bookended by immediate deployment to the ongoing counter-attack. Though far from being able to contest the Clans' fleets, the production of warships appears far from stopping and Archon Steiner is reportedly considering another round of wartime taxes to pay for additional shipyards, slipways, and ships.


With the Lyran counter-attack already well underway as March turned to April, the year's second quarter saw the LCAF's momentum grow as Lyran generals moved additional troops into the mix, thousands of soldiers joining their comrades on the frontline and all but throwing themselves at their enemy. Continuing the strikes against Clans Coyote and Diamond Shark, Lyran troops drawn from deep Lyran territories and mercenaries hired on the open market landed on planets across a hundred-lightyear-wide front as the Commonwealth sought to push back the Clan invaders away from its industrial heartland. Kept fueled, fed, and supplied by an ever growing stream of supply vessels, the titanic force assembled by the Lyran state crashed down upon the Clan defenders of Yeguas, Esteros, Bountiful Harvest, New Exford, Deia, Mkuranga, and Zhongshan like a tsunami, Stars of omnimechs and elementals pulled down and destroyed by a force once considered beneath them.

A forceful blow against the Coyotes and Sharks, June's end saw all nine worlds retaken by the LCAF and images of Lyran flags raised on smouldering Clan mechs to the joy of a populace hungry for good news. However, despite the rosy images presented by Lyran propaganda, reports from ORDI spies within the Lyran government paint a darker, albeit hazier, image of high casualties and bitter fighting; urban warfare on Deia and major ASF battles on and above New Exford costing many lives and robbing the counter-attack's momentum when the Lyrans could ill afford it. Nonetheless, despite the casualties suffered and the gradual loss of momentum, early July saw the morale of the Lyran people reach an all-time high thanks to the spate of victories delivered by the LCAF and the heroic tales of warriors like Morgan Kell, recruitment centres throughout the Commonwealth reporting lines around the block as patriotic citizens attempt to do their part.


Draconis Combine
As hoped by many but assumed by none, April 3050 saw the Draconis Combine finally launch a counter-attack of its own against the invading Clans; troops pulled from across the state assembled into a mighty war host and thrust at the Jade Falcons and Nova Cats like a spear to the gut. Guarded by the Republic's Nocti and transported by JumpShips temporarily seized from local traders, the three-month period saw the DCMS rush at the Clanners in a furious attempt to push them back from Luthien's doorstep. Urged onto new and greater heights of martial achievement by speeches from the Coordinator himself—historically, a rarity from the famous reserved institution—Combine troops fought against the Clanners with an almost religious zeal, the technological gap between the two forces bridged thanks to a combination of international aid and dogged determination.

Again and again, system after system fell to the Combine's push, with Port Arthur, Asgard, Cyrenaica, Kilmarnock, Irece, Juazeiro, and Teniente retaken one after another as superior numbers and all but unbreakable morale saw Clan formations smashed flat. A bitterly fought contest, reporting from ComStar's news services combined with analysis of post-battle imagery by ORDI personnel suggests that these victories were not easy for the DCMS, with casualties numbers assumed to be in the double-digit thousands. Whether the casualty rates sustained in exchange for the pushback of the Falcons and Nova Cats will prove a poison chalice for the Combine remains to be seen, though many across the galaxy hope not.

---

Operation Santiago (Clan Invasion Response)
Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship )

Support Modifiers
Navy:

• +2 (Make-Do Yardships)
• +3 (Tsitsang Fleet Anchorage)
• +5 (Decreased Distance)
• +2 (Parthian-class Mobile Shipyard)
• +2 (ComStar Command Circuit Route)
• -2 (ORDI Donation)

Ground Support Capacity:

• +1 (Tsitsang Ground Facilities)
• +0.75 (ComStar Command Circuit Route)
• +0.25 (Fort Loudon)
• +0.50 (Decreased Distance)
• +1 (Forge Pack)
• +0.50 (Forge Pack)
• +0.25 (Forge Pack)
• -1 (ORDI Donation)

Q2 Casualty Estimates


Casualties To Date


Map of the Inner Sphere (End of June, 3050)

Link to image is here

---

Updated Info Posts
Helghan Republic Order of Battle