Remove ads

The Lords of Ruin -- Battletech/Killzone

View content
Remove ads
Turn 40 Actions (3049)
  • View content
    • Active Goals
    Goals close Dec 31st, 3049

    Completed Goals
    • Habitability Improvement: Improve the general habitability of one of the Republic's less hospitable worlds. [Success: +5 influence. Failure: -2.5 influence]
    • Modernize colony ships: Beginning to show their age after a lengthy career shuttling colonists to their new homes, replacing the Bellerophon-class colony ships with a new design could greatly reduce pressure on our maintenance yards. [Success: +5 influence. Failure: -2.5 influence]
    • Pride of the Fleet: Construct a naval vessel massing 1,000,000 tons. (Must have a BV at least equivalent to other battleship-class vessels of a similar mass) [Success: +15 influence. Failure: -7.5 influence]
    • Expand MAWLR Corps: With memories of war still fresh on people's minds and trouble clearly brewing in the Inner Sphere, a number of concerned citizens and politicians would be put at ease if the Republic were to expand the number of MAWLRs at its disposal. (Must build at least 2 MAWLR packs by Dec 31st, 3049) [Success: +10 influence. Failure: -5 influence] [Progress: 2/2]
    • ORDI Expansion: Convince a nation to join the Outer Rim Defence Initiative as either a full member or as an associate member. [Success: +10 influence. Failure: -5 influence]
    Actions
    You have 10+0 out of 18+1(warp trader sales until EOY 3049) -1 (due to voluntary donations to the ORDIHCR) Action Points to spend. (10 out of 18 for those of you who don't want to bother counting)

    1 AP is being spent on restoring New Oslo's Soletta. 4 AP is being spent on various Outback investments. 1 AP is being spent on the Alphard Republic's JumpShip yard. 1 AP is being spent on Fisher Industrial Centre Final Expansion. 1 AP is being spent on Orbital Shipyard (Detroit).

    New Oslo
    [] Dispatch Additional Security Forces [List dispatched forces here]: A stop-gap measure, deploying additional security forces will at least partly restrict the BOR's freedom of operation.
    [] Infiltrate the Brotherhood of the Righteous [Medium]: By infiltrating the Brotherhood of the Righteous, we can more easily disrupt the group's ability to operate.
    [X] Restore the Soletta Array to Full Functionality: Only restored to partial functionality back in 3037, going back and finishing the job should ease life on New Oslo and buy the Republic some goodwill among those in the equatorial regions. [Progress: 2/3]
    [] Write-in


    Niops Association:
    [] Expand Trade Rights: Having built a minor trade relationship with Niops already, we may be able to pressure them for additional trade rights. [-1 influence]
    [] Arms Sales: Underequipped compared to many neighbouring states, the Association may be willing to buy equipment to help build their military. [-1 influence]
    [] Infiltrate Niops Association Society: A nation which we still know largely nothing about, infiltrating the Niops Association will be difficult but worth it given the level of technology we've detected via space probes.
    [] Tech for Tech: By offering the Association information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.


    Capellan Confederation:
    [] Subsidised Horus Purchases: By subsidising the sale of several Horus-class machines to the Capellan Confederation, we can simultaneously improve the rate of Capellan industrial development and make a tidy profit. [+5,000,000 C-Bills, +2 influence]


    Trinity League:
    [No Actions Until You Make a Decision About The League]


    ORDI Actions:
    Note: Aside from the region-wide industrial investments which are already combined, these actions are listed separately so I can show you both their individual cost and how much each Outback nation is investing into them. I would recommend (and expect) you to combine identical actions together to benefit from the ORDI being willing to back you on one (1) other project.

    Note 2: The Capellan Confederation has agreed to assist you in one item of your choice.

    War Reparations Remaining:
    • FAS: 21 | -6 AP/turn
    • URC: 20 | -7 AP/turn
    [X] Region-wide Industrial Investment: [Region-wide Progress: 9/84] [Locked Until Completed] [+1 AP from Aurigan Coalition, +1 AP from Taurian Concordat, +1 AP from Magistracy of Canopus, +1 AP from Capellan Confederation, +4 AP from local systems using War Reparations]

    [X] Establish National Administration and Rebuild Local Administration (Federation of Autonomous Systems + United Rimward Collective)
    [FAS Progress: 3.5/5] [+1 AP from FAS + 2.5 from ORDI] [Locked Until Completed]
    [URC Progress: 4.5/5] [+2 AP from URC + 2.5 from ORDI] [Locked Until Completed]

    [X] Basic Infrastructure and Housing Development and Repair (Federation of Autonomous Systems + United Rimward Collective)
    [FAS Progress: 1.5/10] [+1 from FAS + 0.5 from Helghan Republic]
    [URC Progress: 1.5/15] [+1 from URC + 0.5 from Helghan Republic]

    [X] Energy Infrastructure Development (Federation of Autonomous Systems + United Rimward Collective)
    [FAS Progress: 1.5/15] [+1 from FAS + 0.5 from Helghan Republic]
    [URC Progress: 1.5/15] [+1 from URC + 0.5 from Helghan Republic]

    FAS Project Tracker
    [X] Establish National Education System and Improve Local Education (Federation of Autonomous Systems) [Progress: 0/15] [Locked Until Completed] [+1AP from FAS]
    [Progress: 0/15] → [Progress: 1/15]

    URC Project Tracker
    [X] Bolster Planetary Militia (United Rimward Collective) [Progress: 0/2] [Locked Until Completed] [+1AP from URC]
    [Progress: 0/2] → [Progress: 1/2]


    Federation of Autonomous Systems
    [] Establish National Taxation System (Federation of Autonomous Systems): Completely lacking a national taxation system, establishing one would allow the FAS to organise and provide numerous goods and services to its constituent systems. [-12,000,000 C-Bills] [Progress: 0/3] [Locked Until Completed] [Requires National Administration]
    [] Establish National Judicial System (Federation of Autonomous Systems): While built around the idea of individual systems holding a great deal of autonomy, establishing the framework for the FAS's national judicial system now would help prevent future issues with jurisdiction and the like. [-12,000,000 C-Bills] [Progress: 0/5] [Requires National Administration]
    [] Improve Local Healthcare Systems (Federation of Autonomous Systems): Wildly diverging in quality even before the Outback conflict and badly disrupted by the same, investing in improvements to local healthcare will save countless millions of lives and greatly reduce suffering in the region. [-150,000,000 C-Bills] [Progress: 0/15]
    [] Construct a National Healthcare System (Federation of Autonomous Systems): With the quality of the region's healthcare system varying wildly from planet to planet (and the wealth of the patient), building a national healthcare system would do wonders to reduce any remaining differences. [-20,000,000 C-Bills] [Progress: 0/3] [Requires National Administration, National Taxation, and Local Healthcare]
    [] Establish National Military (Federation of Autonomous Systems): Though the high degree of autonomy enjoyed by systems within the FAS means that local defence sufficient to ward off pirates is all but automatic, defending against a hostile state requires the creation of a national military operating at the behest of all FAS systems. [-200,000,000 C-Bills] [Progress: 0/5] [Requires National Administration]
    [] Humanitarian Aid (Federation of Autonomous Systems): Ravaged by war and extremely poor even before it achieved independence, committing to supplying humanitarian aid to the Federation's systems would go a long way towards improving the lives of its people. [Minimum: -25,000,000 C-Bills/Turn]


    United Rimward Collective
    [] Establish National Taxation System (United Rimward Collective): Completely lacking a national taxation system, establishing one would allow the URC to organise and provide numerous goods and services to its constituent systems. [-12,000,000 C-Bills] [Progress: 0/2] [Locked Until Completed] [Requires National Administration]
    [] Establish National Judicial System (United Rimward Collective): Designed to be a more traditional state, establishing the framework for a national judicial system will be key to establishing a working government for the URC. [-12,000,000 C-Bills] [Progress: 0/4] [Requires National Administration]
    [] Establish National Education System and Improve Local Education (United Rimward Collective): Severely lacking in the first place and with the civil war having further disrupted education services, establishing a national education system and rebuilding the existing education systems of individual planets will help provide a decent education to billions. [-100,000,000 C-Bills] [Progress: 0/15] [Locked Until Completed]
    [] Improve Local Healthcare Systems (United Rimward Collective): Wildly variable even before the Outback conflict and badly disrupted by the same, improving local healthcare will save countless millions of lives and greatly reduce suffering in the region. [-150,000,000 C-Bills] [Progress: 0/15] [+1 from URC]
    [] Construct a National Healthcare System (United Rimward Collective): With the quality of the region's healthcare system varying wildly from planet to planet (and the wealth of the patient), building a national healthcare system would do wonders to reduce any remaining differences. [-20,000,000 C-Bills] [Progress: 0/2] [Requires National Administration, National Taxation, and Local Healthcare]
    [] Establish National Military (United Rimward Collective): Sure to be a vital part of keeping URC worlds out of FedSun hands, helping the URC to build a national military will be expensive but highly beneficial to the Republic.. [-200,000,000 C-Bills] [Progress: 0/4] [Requires National Administration]
    [] Humanitarian Aid (United Rimward Collective): Ravaged by war and extremely poor even before it achieved independence, committing to supplying humanitarian aid to the Collective's systems would go a long way towards improving the lives of its people. [Minimum: -25,000,000 C-Bills/Turn] [Can be altered/dropped at any time]


    Alphard Republic:
    [X] JumpShip Yard Development: Having promised to help the Alphard Republic to construct a jumpship yard, it behoves the Republic to get a start on that ASAP. [Progress: 1/4] [Locked Until Completed]


    Federated Suns:
    [] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Stage diplomatic incident [Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/12 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Continue NAIS Infiltration [Medium-Hard]: Continuing prior efforts to infiltrate the New Avalon Institute of Science is vital if we want access to their latest designs and most secure production sites.
    [] Steal research [Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Infiltrate Davion Palace [Hard]: By infiltrating the Davion palace, we can gain access to its most vital secrets and most important people.
    [] Write-in:


    Lyran Commonwealth:
    [] Expand Lyran intelligence network: Having placed a large number of agents within the lower levels of Lyran society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Medium]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Steal research [Very Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Very Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]


    Free Worlds League:
    [] Expand League intelligence network: Having placed a large number of agents within the lower levels of League society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Hard]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Extremely Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in (Convince me you've got something good)


    Draconis Combine:
    [] Arms Sales: With the Combine now at war, they may be willing to purchase items up to and including formerly LosTech ammunition from the Republic. Given the distances involved, such shipments will be very difficult until efforts are made to improve the backend logistics. [-5 influence]
    [] Tech for Tech: By offering the Combine information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.
    [] Expand Combine intelligence network: Having placed a number of agents throughout Draconis society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Impossible]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-15,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in


    Planetary Development:
    [] Terraforming (Castile): De facto owned by the Republic due to its location, the jungle world of Castile is almost but not quite habitable despite its invitingly green surface. Lethally hot everywhere but the poles thanks to its CO2 rich atmosphere and sporting a huge variety of mind-rotting fungus, Castile will require years of work before humans can survive outside of sealed environments and at least a century more before it can be called completely terraformed. [Progress: 0/4] [Reduced from 6 due to 25% Gene-Tailoring Tech]
    [] Terraforming (Bastion): De facto owned by the Republic due to its location, the Titanian world of Bastion might not initially strike one as a habitable planet but could, with some effort, be made to work. Similar in size and composition to Titan in the Sol system, habitation of Bastion could be made possible through the two-stage construction of vast solar mirrors in orbit above the world and air-tight arcologies on stable plateaus. Though complete terraformation would take at least a century to carry out using current technology, millions could live comfortably encased in sealed arcologies warmed from orbit. [Progress: 0/4] (Reduced to 66% by Ecological Adaptation)
    [] Colonise Contrilla: Temperate and wet but otherwise quite comfortable for those used to Helghan, colonising Contrilla will add yet another world to the Republic's collection. [Action Locked Until Completed] [Progress: 0/500,000]
    [] Colonise Ares: A cold and barren planet the size of Mars that orbits a red dwarf star, Ares is nonetheless on the colonisation list by virtue of having a strong magnetic field produced by a still-liquid core. In addition, Ares's single moon (a captured stony-iron asteroid) is an easy-to-exploit source of building material for orbital infrastructure such as orbital shipyards, space elevators, etc. [Action Locked Until Completed] [Progress: 0/500,000]
    [] Colonise Nike: A warm and somewhat dry world orbiting a little closer to its F-Type primary than many would like, Nike is a veritable Eden compared to many other planets throughout the galaxy. Half the size of Earth and with half the gravity, Nike's vast primaeval forests are home to similarly gigantic trees, the living structures dwarfing Earth's extinct Redwoods. Of particular note are the planet's seven asteroid-capture moons, prime building blocks for orbital construction and resource exploitation. [Action Locked Until Completed] [Progress: 0/500,000]
    [] Colonise Boreas: Appearing from orbit as a stark white ball of ammonia clouds shot through with the occasional red, brown, and yellow courtesy of trace gases, Boreas would not be a colonisation candidate were it not for the stubbornly persistent quantity of Methane in its atmosphere. Though technically a rocky planet thanks to the stony surface buried beneath the clouds, Boreas's hostile environment naturally precludes extensive surface colonisation. Nonetheless, given the potential presence of unique alien lifeforms and their valuable biochemistries, a case could be made for a small orbital habitat able to house ten thousand people or so. [Action Locked Until Completed] [Progress: 0/4 AP]
    [] Orbital Shipyard (Helghan): Necessary to construct ships massing between 600,000 to 1,000,000 tons due to the limitations of anti-gravity drives, an orbital shipyard over Helghan will allow the Republic to construct much heavier vessels in batches of 3. [Progress 0/2] [Action Point Locked Until Completed]
    [] Targeted Gene-Plagues (Spencer): Having long suffered from native pest species, unleashing targeted gene-plagues on said species would greatly alleviate the burden on the planet's farmers. [Must be started the year after the tech is researched]
    [] Construct a Petrusite synthesis plant on: [LOCATION]
    Locations Available:
    • Helghan
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]

    [X] Fisher Industrial Centre Final Expansion: A final round of investment into the Fisher Industrial Centre will allow the Republic to max out the satellite facility's productivity to 3 battalions worth of mechs per year. [Progress 1/2]
    [X] Orbital Shipyard (Detroit): Necessary to construct ships massing between 600,000 to 1,000,000 tons due to the limitations of anti-gravity drives, an orbital shipyard over Detroit will allow the Republic to construct much heavier vessels in batches of 3. [Progress: 1/2]


    Politics:
    [] Expand Jezero Production Facilities: With additional investment from the Republic government, we can significantly increase the Jezero facility's nuclear production capabilities. [Progress: 0/2]
    [] Sell Battlemech Battalion [TARGET NATION]: Equally as good as an Inner Sphere-produced mech, selling Republic mechs to other nations is a surefire way to raise capital --albeit at the cost of diverting production away from the Republic's own military. [+Variable C-Bills]


    Aerospace:
    [] Construct a Charon-class freighter: Task your shipyards with constructing a Charon-class freighter. [Can be taken multiple times in a turn]
    [] Construct a Bellerophon-class colony ship: Task your shipyards with constructing a Bellerophon-class colony ship. [Can be taken multiple times in a turn]
    [] Construct a Rokh-class MAWLR transport Group: Task your shipyards with constructing three Rokh-class MAWLR transports. [Can be taken multiple times in a turn]


    Military:
    [] Raise an Army: Task your military with forming an additional army. [Can be taken multiple times in a turn so long as there is recruitable population remaining]
    [] Construct two Hasta-class cruiser Squadrons: Task your shipyards with constructing Six Hasta Cruisers. [Can be taken multiple times a turn]
    [] Construct two Hasta IIIC-class cruiser Squadrons: Task your shipyards with constructing Six Hasta IIIC Cruisers. [Can be taken multiple times a turn]
    [] Construct two Hasta IIID-class cruiser Squadrons: Task your shipyards with constructing Six Hasta IIID Cruisers. [Can be taken multiple times a turn]
    [] Construct one Noctis-class cruiser Squadrons: Task your shipyards with constructing three Noctis Cruisers. [Can be taken multiple times a turn]
    [] Construct a Damascus-Class Carrier Squadron: Task your shipyards with constructing a squadron of Damascus-Class Carriers. [Can be taken multiple times a turn]
    [] Construct a Toxotai-class Guided Missile Cruiser Squadron: Task your shipyards with constructing a squadron of Toxotai Guided Missile Cruisers. [Can be taken up to four times in a turn]
    [] Construct a Parthian-class Mobile Shipyard: a set of twelve Jump-Capable shipyard stations carried by a Warp Trader warship, the Parthian is intended to make close to Frontline repair and maintenance easier.
    [] Construct 12 Guardsman-class Pocket Warships: Task your shipyards with constructing 12 Guardsman-class pocket warships. [Can be taken multiple times a turn]
    [] Hecatoncheires-class Escort Carrier Squadron: Task your shipyards with constructing a squadron of Hecatoncheires-class Escort Carriers. [Can be taken multiple times in a turn]
    [] Construct a MAWLR-II pack: Task your heavy industry with constructing a pack of three MAWLR-IIs. [Can be taken multiple times in a turn]
    [] Construct a SAHLR pack: Task your heavy industry with constructing a pack of three SAHLRs. [Can be taken multiple times in a turn]
    [] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Can be taken multiple times in a turn]
    [] Construct a Hydra pack: Task your heavy industry with constructing a pack of three Hydras. [Can be taken multiple times in a turn]
    [] Construct a Dragon pack: Task your heavy industry with constructing a pack of three Dragons. [Can be taken multiple times in a turn]
    [] Construct a Pyrrhus pack: Task your heavy industry with constructing a pack of three Pyrrhuses. [Can be taken multiple times in a turn]
    [] Construct eight Battlemech Battalions: Task Fisher & Zulim Taw with constructing eight battalions worth of mechs.
    [] Construct a military defence station over [LOCATION]
    Locations available:
    • Cassilda (None → Small)

    [Can be taken multiple times in a turn]

    [] Expand a military defence station over [LOCATION]
    Locations available:
    • Caliban (Medium → Large)
    • Charybdis (Medium → Large)
    • Highwater (Medium → Large)
    • Mir (Medium → Large)
    • Tiverton (Medium → Large)
    • Contrilla (Small → Medium)
    • Detroit (Small → Medium)
    • Mantharaka (Small → Medium)
    • New Oslo (Small → Medium)
    • Rogue (Small → Medium)
    • Spencer (Small → Medium)

    [Can be taken multiple times in a turn]

    [] Construct Secondary Fleet Anchorage in [LOCATION]
    Locations available (Must have at least a B rating for both Technological Sophistication and Industrial Development):
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit

    Extrasolar Politics:
    [] Annex Tarragona: A planet of little consequence despite its wealth of heavy metals and fissionable materials, the Republic could absorb Tarragona without much complaint from its neighbours. [-2 influence]
    [] Annex McEvans' Sacrifice: An arctic iceball empty of any sign of human life save for a dropship found half-buried in a glacier, the only question anyone is liable to ask the Republic after annexing McEvans' Sacrifice is "why?" [-1 Influence]


    Exploration:
    [] Send out Explorers: The final frontier, one filled with wonder and terror alike, space exploration offers many potential benefits for those willing to risk its hazards. ← Will be automatically picked by the HISSS unless otherwise ordered.
    [] Assist Taurian Explorers: With several prominent factions in the Concordat interested in colonising additional solar systems, it may be politically beneficial to assist them in their exploration efforts.


    Terra Group (Automated):
    [x] Mineral Surveys (Highwater): A world with a history of supplying its Periphery neighbours with ore, Highwater could do with another round of mineral surveys. [Progress: 1/2]


    Warp Communications Consortium (Automated):
    [X] FTL Comms Expansion. [Progress: 29/80 turns] (+1 AP From Taurian Concordat, +1 AP From Aurigan Coalition, +1 AP From Magistracy of Canopus, +1 AP From Capellan Confederation) [Increased Due To Territorial Expansions]


    Helghan Interstellar Scouting & Survey Service (Automated):
    [SELECT ACTION]


    Helghan Bureau Of Ship Procurement (BuPro) (Automated):
    [SELECT ACTION]
    Note: Selected shipbuilding actions won't count against your AP cost so long as you mark it as being for BuPro using the nation tag. You can only select one build action per turn. The format should be [] ACTION NAME [PURCHASING NATION TAG]

    Purchase Interest:
    • Hasta [CapCon] [Magistracy]
    • Hasta IIIC [CapCon] [Magistracy] ← Will be picked by BuPro for sale to the Magistracy if no other option is selected
    • Damascus [CapCon] [Magistracy]
    • Justice [CapCon] [Magistracy]
    Research
    [X] Long Range Sensors [Progress: 4.8/6]
    [X] Swarm Robotics [2.35/8]
    [X] High-Gain Transceivers [1.9/10]
    [] Free Research Slot [1.8/--]
    [] Free Research Slot [1/--]
    [] Free Research Slot [0.75/--]
    [] Free Research Slot [0.65/--]
    [] Free Research Slot [0.1/--]
    [] Temporary Research Slot [0/--] [Granted by the Taurian Concordat]

    ORDI Research
    [X] Improved Anti-Gravity Drive [4.8/10]

    Military Requisition And Design
    You have 4 out of 4 Requisition Points to spend on upgrading Helghan's ground forces. These upgrades are given to all active armies at once, though the more armies you have the longer it'll take to roll out changes.

    Requisition

    Design
    [] Dropship Design: (tell me what you're trying to design)
    [] MAWLR Redesign: Order your design teams to redesign the MAWLR to make use of the latest technological advancements.
    [] Design write-in: Order your teams to design a solution to a capability gap. (tell me what you're trying to design)
     
    Last edited:
  • View discussion
    • Turn 40 Results (3049)
  • View content
    • [X] Plan: Internal Development.

    https://forums.sufficientvelocity.com/threads/the-lords-of-ruin-battletech-killzone.52819/page-1072?post=31197328#post-31197328

    Active Goals
    Goals close Dec 31st, 3049

    Completed Goals
    • Habitability Improvement: Improve the general habitability of one of the Republic's less hospitable worlds. [Success: +5 influence. Failure: -2.5 influence]
    • Modernize colony ships: Beginning to show their age after a lengthy career shuttling colonists to their new homes, replacing the Bellerophon-class colony ships with a new design could greatly reduce pressure on our maintenance yards. [Success: +5 influence. Failure: -2.5 influence]
    • Pride of the Fleet: Construct a naval vessel massing 1,000,000 tons. (Must have a BV at least equivalent to other battleship-class vessels of a similar mass) [Success: +15 influence. Failure: -7.5 influence]
    • Expand MAWLR Corps: With memories of war still fresh on people's minds and trouble clearly brewing in the Inner Sphere, a number of concerned citizens and politicians would be put at ease if the Republic were to expand the number of MAWLRs at its disposal. (Must build at least 2 MAWLR packs by Dec 31st, 3049) [Success: +10 influence. Failure: -5 influence] [Progress: 2/2]
    • ORDI Expansion: Convince a nation to join the Outer Rim Defence Initiative as either a full member or as an associate member. [Success: +10 influence. Failure: -5 influence]
    New Oslo
    [X] Restore the Soletta Array to Full Functionality: Only restored to partial functionality back in 3037, going back and finishing the job should ease life on New Oslo and buy the Republic some goodwill among those in the equatorial regions. [Progress: 2/3]
    Article:
    "It's not too late to run," a voice murmured beside her, the whispered words barely audible over the clack-clack-clack of horseshoes on pavers.

    Shifting in her seat as the carriage rocked back and forth, her voluminous dress bundled up around her feet like an animal skin ten times too big, Anna peered past the eaves of her flower crown at the face staring back at her; Klaus' shock of red hair a blazing fire. From beneath his sable fur cap, the young trader watched her with jade green eyes, his face splitting into an unselfconscious grin as she stuck out her tongue and took his hand.

    "I know the coachman well enough," he continued as he leaned in against her, the warmth of his body spilling through the multitudinous layers of crimson silk and countering the breeze that flowed into the open-topped carriage. "With a word, we can run away and be married before our families notice."

    Leaning into him, Anna sighed, the thrill of his touch sending her heart careening in her chest even as she fought to keep her face serene. It had only been a year since they'd agreed to marry, but already she was familiar with his every mood and manner, each hitch and intonation a book just like the ones that filled her home. Gone was the shy and awkward youth she'd known since childhood, time's slow march maturing timidity into gentleness and gangliness into a handsome figure.

    "You wouldn't dare," she countered, jutting her chin forward as she glanced at the street around them, familiar faces peering out of windows and leaning over balconies to watch as the carriage wound its way through Rossön's streets, shrieking whistles and joyful cries rising from every corner as tradition demanded.

    "Not unless you willed it," Klaus agreed before schooling his features into something resembling solemnity as the carriage made the final turn towards the church, a roar of approval emerging from the crowd gathered at its steps.

    Grinning despite herself as the carriage groaned to a halt, Anna gave her fiance's hand one final squeeze before hauling herself, blinking, into the silvery ghost fire of the planet's second sun...


    With the task's end so nearly within their grasp, 3049's dawn saw Helghan workers throw themselves into the effort of completing New Oslo's vast soletta array, a whole galaxy of torches erupting around the snowflake structure in early January as work began to move the last few hundred metres of trusswork into position and weld them in place. Already ninety percent of the way towards completion at the month's start, it took only six weeks for the throng of suited workers and their accompanying automata to finish laying the groundwork for the remaining mirrors; each passing day seeing literal tons of silver-white trusses manoeuvred into position and secured in place until, at last, the snowflake-like station had reached its final, colossal, diameter. Suddenly freed of the distraction provided by the work—and quickly reinforced with reassigned workers and machines—the now substantially larger force of mirror layers redoubled their efforts to finish the planetary terraformation engine, placement rates skyrocketing as the end of their three-year goal neared.

    Manufactured across the Republic and shipped across lightyears of space by a stream of freighters so constant that some did, in fact, set their watches by their arrival, the near perfectly reflective hexagonal mirrors that made up the array's compound structure erupted across the snowflake structure with prodigious speed—whole zones filled out almost overnight. Catching ever more sunlight as the swarming workers finished section after section of the compound mirror, the brilliant glow of the soletta only brightened in the skies above New Oslo as painstakingly programmed software directed every watt collected to some chilled city or frozen landscape. Then, almost before anyone had noticed, it was November, and the last mirror was in place.

    Rather pleased with themselves for delivering the project within the projected time frame—if only barely—and well aware that New Oslo celebrated the December period with holidays and other festivities, 3049's final weeks saw the project's workers symbolically give the mirror to the planet's people. A Juldagen present to put all others to shame, the gift of the mirror—and its life-bringing heat and light—was received with jubilation from the inhabitants of those equatorial cities that had gone without for centuries, the ghostly fire that blazed down upon the land a welcome balm.

    [Progress: 2/3] → [Progress: 3/3]

    Effect
    • New Oslo Soletta complete.
    • Every major city on the planet is receiving additional heat and light, as are farmlands in every nation.
    • People are extremely happy.

    Outback
    War Reparations Remaining:
    FAS: 9 | -6 AP/turn
    URC: 20 | -7 AP/turn

    [X] Region-wide Industrial Investment: [Region-wide Progress: 9/84] [Locked Until Completed] [+1 AP from Aurigan Coalition, +1 AP from Taurian Concordat, +1 AP from Magistracy of Canopus, +1 AP from Capellan Confederation, +4 AP from local systems using War Reparations]
    The Federated Suns left these people cripplingly poor despite the wealth lying beneath their feet, and when you do that—when you take away their ability to feed and clothe their families, to keep them healthy and happy—well then that person will get angry and lash out. I view our work here, constructing factories and the like, the same way I view defusing a bomb: difficult, dangerous, and utterly vital.

    We aren't changing the past here; what we are is changing the future.     - James Hoxha, Foreman, ORDI International Development Programme.

    Dismayed but not discouraged by the sudden appearance of the Clans and the equally sudden constriction of shipping throughput as their home nations launched an expeditionary force to the other side of the Inner Sphere, the Outback's multinational army of visiting workers greeted January 3049 by doubling down on the effort of improving the region's industrial capabilities. Continuing to work feverishly across the fifty-plus solar systems that made up the former Outback, 3049 saw ORDI personnel do everything from laying train tracks between once-isolated cities to dredging harbours left to rot by the Federated Suns, each passing day seeing more and more of the region's wealth freed to improve the lives of the billions who remained impoverished. Throughout the Federation of Autonomous Systems and the United Rimward Collective, many millions woke each day to find their lives made just that much easier thanks to the ORDI's labours, spare parts cheaper to buy, mechanics easier to find, and once-back breaking work steadily diminished.

    However, as the months passed and the sands of winter left Pyrrhus for another year, tensions between the United Rimward Collective's leading political movements only grew as rumours curdled into venom and rhetorical knives flashed. Expecting the URC to invest heavily in its own industry and figuring said investment into their plans, ORDI workers were first confused and then alarmed when milestones began to slip for all projects within the fractious nation, investigation revealing the wheels of governance grinding to a halt as what passed for the URC's government reached a deadlock. Worse still, as the nation's informal national government finally fell victim to total paralysis, ORDI personnel found themselves prevented from carrying out even the most basic of tasks within the Collective, planetary governments too disorganised for industrialisation efforts to effect meaningful progress.

    [Region-wide Progress: 9/84] → +2 from FAS +0 from URC + 5 from ORDI → [Region-wide Progress: 16/84]
    Effect
    • Steady progress despite the Clan invasion… until the URC government hits total deadlock
    • Progress is locked to a max of 42 until the URC is no longer in crisis

    [X] Establish National Administration and Rebuild Local Administration (Federation of Autonomous Systems + United Rimward Collective)
    Ladies and gentlemen, friends old and new, we have it in our power to begin the world over again. To grasp the hands of the clock that has governed our fates and our peoples' fates since long before we were born and wrench them forward those five centuries we lost. To return, again, to a place where freedom is the birthright of all sentient beings and deliver to those that follow us a better tomorrow.

    Do I wish the Constitution on offer was perfect? Yes. Do I believe it is the best we can hope to obtain? Yes!

    Friends, comrades, countrymen, vote with me: Aye!     - Sylvester M. Brierley, Governor of Wrentham, Palace of the Federation (fmr. Ducal Palace, Taygeta), October 11th, 3049.

    Having finalised the overall design of the nation's government the year prior and with the initial agreement of the Federation's proposed members secured, 3049 saw the ORDI's horde of lawyers, diplomats, and lawmakers put their all into making the confederal nation a reality—a two-part plan launched within weeks of the year's start.

    The most straightforward part of the plan to put into motion, and the most rewarding from a certain point of view, 3049's first quarter saw the best negotiators in the whole ORDI launch a wine and dine campaign unmatched in the alliance's increasingly long history. Confronted by a bevy of food and drink from the finest chefs and vineyards in the Rimward Periphery, decision-makers from among the two dozen systems of the proposed Federation found themselves slowly convinced of the Federation's long-term viability and how the voluntary union was in the best interest of their people. Rising to power on the backs of a desire for a change in circumstances and presented with a convincing argument from their ORDI counterparts, one group after another drifted towards the ORDI's way of seeing things until, at last, interest in forming the Federation of Autonomous Systems transitioned from faint to substantive.

    Elsewhere in the rapidly blossoming Federation—experiencing a rewarding if substantially more difficult time—ORDI administrators and their wild assortment of staff engaged in the much-needed but distinctly stultifying task of reassembling the region's shattered governments. Though groups such as the Marxist-Leninist-Kerenskyists, the Sin Seda, and many others had done much to rectify the cracked and broken administrations ruling over the proposed nation's two dozen member systems, the complexities of effective planetwide governance combined with a newfound need to run said planets in the interest of their inhabitants rather than stock owners meant that said administrations had numerous positions to fill. Well aware that installing placemen into said gaps would be a short-term solution to a potentially lethal problem, the ORDI's personnel instead choose to elevate locals into the roles; effective candidates identified with the help of knowledgeable locals and given intensive crash courses in whatever subjects and theory would assist them in their new roles. Much to the credit of both, the vast majority of candidates soon proved their worth by rising to the challenge by the year's end, effective local governance restored to the Federation's systems in time for the nation to formally come into being.

    In contrast, efforts by ORDI personnel to do the same within the United Rimward Collective faced immediate issues thanks to the proposed nation's increasingly fractured politics; early successes in the year's first half halted or else completely undone by December. Though negotiations with both Marxists and neo-Jacobinists showed that the two movements were interested in the idea of a unified nation to fend off the Federated Suns, attempts to bring the two to the table failed consistently. While the Marxists initially proved willing to work with neo-Jacobnists, at least in the abstract, said Marxist groups found themselves increasingly isolated as the year went on—the movement almost totally constrained to the proposed capital of Firgrove by December. Likewise, attempts to convince neo-Jacobinists to work with Marxists all but froze by the year's end for seemingly little reason, and ORDI negotiators were left frustrated by the entire experience.

    However, with that said, measures to ensure that Rimward Collective systems could at least govern themselves came to fruition almost painlessly; both Marxists and neo-Jacobinists proved willing to work with the ORDI to improve the lives of their people. Mimicking those actions being carried out by their colleagues on the other side of the former Outback over the same period, ORDI personnel identified, elevated, and trained select members of the local populace to take on those roles left to lie fallow after the Outback intervention, the gears of local governance slowly grinding to life by 3049's end.

    [FAS Progress: 3.5/5] → +1 AP from FAS + 2.5 from ORDI → [FAS Progress: 7/5]
    [URC Progress: 4.5/5] → +0 AP from URC + 2.5 from ORDI → [URC Progress: 7/5] [NO EFFECT UNTIL SOME SOLUTION IS MADE]

    Effect
    • Federation of Autonomous Systems now exists as more than a name on the map (though only just). Effective local government restored to the region.
    • Effective local government restored to the URC, but the entire thing is deadlocked at the point that they could be more than a name… but aren't.
    • Overflow goes towards smoothing out local government issues

    [X] Basic Infrastructure and Housing Development and Repair (Federation of Autonomous Systems + United Rimward Collective)
    It was once said
    That without darkness,
    Nothing comes to birth.
    As without light,
    Nothing flowers.

    Lift out the pain, the hate, the rancour.
    Put the wild hunger where it belongs,
    Within the act of creation.
    Or else the living child will be stillborn. -     Étienne, Ankur H. "The Second Invocation to Kali." Conversations From the Cafés Along the Rue des Thermopyles, edited by Evgenia Sala, Marauder Manuscripts, 3049, pp. 25.

    Meanwhile, those Republic personnel tasked with the far more prosaic challenge of rebuilding the devastated infrastructure and housing of the former Outback took to their tasks with new appetite as December 3048 rolled into January 3049. Though finding reliable access to supplies a challenge due to the sudden appearance of the Clans and the resulting shifts in supply availability and shipping services, the Republic's army of workers and their Horus MKIIs nonetheless worked themselves to the bone to carry out their tasks; a truly astounding number of person-hours spent constructing everything from power lines to superblocks as the year progressed. Aided by Marxist and neo-Jacobinist groups alike—though rarely on the same planet—the work saw shattered cities across the region begin to heal as the scars of war were patched over and new growth coaxed from what remained.

    With that said, while the Republic succeeded in housing many hundreds of thousands of displaced people in new homes and restoring necessities such as power, water, and sewage to many more over the year, those workers based in the United Rimward Collective found the increasingly chilly political scene hindering their ability to provide for the dispossessed. Though neither the Marxists nor neo-Jacobnists proved inclined to actively slow Helghan's efforts to provide for the people of the ravaged region, the many weaknesses in local government combined with the comparative inability to marshall the nation's resources meant that Helghan workers found themselves outstripped by their equivalents within the Federation of Autonomous System when it came to meeting milestones. An ill-omen for the future regardless of the cause, the one thing Helghan analysts can agree on—aside from the URC's movements needing to sort their problems out—is that this is liable to induce anger among the dispossessed should the situation persist.

    [FAS Progress: 1.5/10] → +1 from FAS + 0.5 from Helghan Republic → [FAS Progress: 3/10]
    [URC Progress: 1.5/15] → +0 from URC + 0.5 from Helghan Republic → [URC Progress: 2/15]

    Effect
    • Progress continues RE restoring infrastructure and housing, but the FAS is pulling ahead due to the URC having political issues.

    [X] Energy Infrastructure Development (Federation of Autonomous Systems + United Rimward Collective)
    I don't have a timeline for retirement. I figure I'll just do this till it hurts. - Maria Anker (Electrician)

    Simultaneously with actions to rebuild the Outback's shattered infrastructure and funded by the same massive infrastructure bill passed by the Republic's parliament last year, Helghan workers continued efforts to provide heat, light, and electricity to the region's billions of inhabitants as December gave way to January 3049. Well equipped by any reasonable standard and operating without much concern for broader political trends, Republic workers laboured day and night alongside local peoples and swarms of automata to construct the vast amount of infrastructure required; the steady stream of warpcraft supplying the program rivers in the skies above many tens of worlds. As variable as the planets they supported, the solutions developed by Republic engineers ranged from the simple—such as additional gas power plants for those systems with a semi-developed economy and suitable stocks of fossil fuels—to the picturesque—such as horizon-filling fields of stately windmills.

    Alongside these more conspicuous aspects of the program, the year also saw Helghan workers resume the far more prosaic task of laying down power lines across the various planets of the Outback. Continuing from where they left off at the end of 3048, Republic personnel laid down hundreds of thousands of kilometres of distribution and transmission cable in a little under a year, each kilometre of which weighed 100 tons or more. Still years away from completion despite the steadily improving generation and distribution capacity and the continued support of the Republic government, 3049's close nonetheless saw countless millions of people in the Federation and Collective experience their first taste of electricity, the dark just that little less threatening as a result.

    [FAS Progress: 1.5/15] → +1 from FAS + 0.5 from Helghan Republic → [FAS Progress: 3/15]
    [URC Progress: 1.5/15] → +0 from URC + 0.5 from Helghan Republic → [URC Progress: 2/15]

    Effect
    • Progress continues in both nations despite political deadlock in URC, though said deadlock has prevented the URC from properly assisting.

    FAS Project Tracker
    [X] Establish National Education System and Improve Local Education (Federation of Autonomous Systems) [Progress: 1/15] [Locked Until Completed] [+1AP from FAS]
    [Progress: 1/15] → [Progress: 2/15]

    URC Project Tracker
    [X] Bolster Planetary Militia (United Rimward Collective) [Progress: 1/2] [Locked Until Completed] [+1AP from URC]
    [Progress: 1/2] → [Progress: 1/2]
    SUSPENDED DUE TO DISJUNCTION

    Alphard Republic
    [X] JumpShip Yard Development: Having promised to help the Alphard Republic to construct a jumpship yard, it behoves the Republic to get a start on that ASAP. [Progress: 1/4] [Locked Until Completed]
    As I stepped out over the edge of the scaffolding, dodging past the swarming worker drones bearing more construction materials, I saw Alphard for what it truly was: small, amber, and so touchingly interconnected.

    Floating there, it suddenly struck me that every part of the planet reacted with every other part. That it was all one thing and that every little animal, every faint stirring of wind, and every lapping wave was important to that system. There's a message in that, I think.     - Cecilia Terzić, Construction Crew #9, Alphard

    Eager to keep their promise to the Alphard Republic even with the Clan Invasion constantly snatching attention away from the work, the Malkiewicz government did what it could to ensure that the flow of supplies to the in-progress shipyards remained uninterrupted as the year progressed; fast food restaurants throughout Pyrrhus reporting their best year yet, inundated as they were with orders from a civil service commanded to find a way. Already halfway complete thanks to prior work, January 3049 saw the automata soaring above Alphard—and their accompanying humans—throw themselves into the work of finishing the shipyard's incomplete berths, the kilometre-long frames that would soon construct JumpShips quickly surrounded by miniature galaxies thanks to the sheer number of welding torches present. Agile as the insects they so often mimicked, construction automata swarmed and scuttled across the metal enclosures they so diligently worked to construct, the vast beams of composite and metal they levered into place filling out the structures until cages became slipways.

    Working with mindless efficiency and guided by rather more mindful managers, the automatas' efforts to construct the young nation's first shipyard proceeded apace until, at long last, early December saw the final pieces of the outer structure put in place. Marked by a minor celebration by those humans involved, the completion of the proposed shipyard berths was also greeted with a change in the components shipped in from the ORDI's member-states; base materials like composites and steel giving way to speciality manufacturing equipment ready to be installed next year.
    [Progress: 1/4] → [Progress: 2/4]

    Effect
    • Work continues steadily.
    • Alphard Government is happy with the progress.

    Planetary Development
    [X] Fisher Industrial Centre Final Expansion: A final round of investment into the Fisher Industrial Centre will allow the Republic to max out the satellite facility's productivity to 3 battalions worth of mechs per year. [Progress 1/2]
    Building off last year's successes in carving out and lining the caverns that would play host to the Fisher Industrial Center's expanded factory lines, January 3049 saw Republic workers turn their attention to filling the ferrocrete chambers with the assorted sundries necessary to turn them into production powerhouses. Shipped in from other Republic systems or else produced locally, a supply of manufacturing equipment best measured in hundreds of tons was installed in the semi-cylindrical chambers, automata the size of houses lowering them into position and ones the size of mice connecting them to the winding network of pipes and cables established for just that purpose. A painfully slow process by the standards of the bulk work that had come before, each day saw more and more of the delicate but vital equipment installed until, by mid-October, the last of the machinery was in place and ready to be activated; stockpiles of materials already waiting to be used.

    Much to the relief of local and federal governments, the November test run proved more than up to snuff, the initial line of parts passing quality assurance with flying colours after only a handful of false starts. Dotting their Is and crossing their Ts until well into December, Republic workers celebrated the successful conclusion of their work by popping open champagne bottles and announcing the third and final expansion of the Fisher Industrial Center complete.

    [Progress: 1/2] → [Progress: 2/2]

    Effect
    • Third and final expansion completed.
    • +1 battalion per mech production action starting from Jan 1 3050 (I.E you make 3 regiments now)

    [X] Orbital Shipyard (Detroit): Necessary to construct ships massing between 600,000 to 1,000,000 tons due to the limitations of anti-gravity drives, an orbital shipyard over Detroit will allow the Republic to construct much heavier vessels in batches of 3. [Progress: 1/2]
    Think this one will stay up? - Maksim Nikolajsen, Engineer

    Already half finished thanks to the sheer amount of resources poured into its construction last year, early 3049 saw Detroit's second orbital shipyard surrounded by a halo of light as starships, dropships, automata, and humans continued their fast-paced construction work; space around the incipient shipyard so thick with traffic that sky watchers below found familiar constellations obstructed. Similar in shape to the carbon nanotubes used to construct space elevator cables, the trio of kilometre-long hexagonal prisms that had enjoyed a Christmas in orbit over Detroit underwent a rapid series of changes as the months wore on, megatonnes of material bolted, welded, and epoxied onto their superstructures in accordance with the same plans that had served the Helghan Republic so successfully the last time. Planned out in exacting detail and monitored closely for any signs of delay or sabotage—a concern that had only grown with the sudden appearance of the Clans and the equally sudden revelation of the Dragoons' origins—it was a matter of great satisfaction for the project's labourers when work on the shipyard's superstructure was completed within days of the original estimation.

    With the river of cargo arriving at the building site changing from bulk materials to specialist manufacturing equipment shortly after the final pieces were emplaced, the following months saw rapid progress made as Helghan workers installed the delicate machinery needed to construct megatonne-scale warships. Taking the form of specialist 3d printers, high-precision manipulators, powerful cutting lasers, and countless other systems, the installation of these fragile but utterly vital production tools took until the end of December to finish; the last one installed with much fanfare by the same crew of workers who had installed the first. Having watched with bated breath the entire time, the Christmas-time opening of the shipyard saw Detroit's government breathe a sigh of relief at the thought that they would once again be the Republic's centre of heavy shipbuilding, for the time being, at least.
    [Progress: 1/2] → [Progress: 2/2]

    Effect
    • Detroit shipyard finished.
    • +20 naval upkeep
    • Can build 3x 1mt ships simultaneously at a maximum rate of 1 batch every 2 years.

    Politics:
    -[X] Research deal: Give the Capellans, Taurians and Canopians Improved Petrusite theory in exchange for them researching the following clan tech which we will also give them the associated research bonuses for and sharing it with all ORDI members. Taurians: Clan Structure Materials, Capellans: CDHS and Canopians: Clan ER PPC. Alongside this deal we will also give the Aurigans our Major Pulse Laser Research Bonus (25%) x1 (to finish their primitive Helgan pulse laser research) and Major Energy Weapons (Energy Weapon Examples +2 minor) (25% bonus) x1 (to add extra research points to the Standard Helghan pulse lasers research that they will start after completing primitive) to speed up their Pulse Laser research and Capellans Major Battle Armour Research Bonus (25%) x2 for the same reason. The Republic will also share ERLAMS and Countermissiles for a no cost (besides Influence) so our allies can better protect their ships against BPL's.
    With the Clan Invasion revealing that, for once, the Outer Rim Defence Initiative did not hold a clear technological lead over all possible opponents in the galaxy and with members of Operation Santiago feeling the consequences, mid-3049 saw the Helghan Republic reach out to its allies with an offer designed to ease their minds. Having collected a great deal of battlefield salvage—and with more gathered every day of the invasion—the ORDI had found itself sitting on a stockpile of valuable technologies and samples it had no plans to use. Eager to rectify this mistake, the Helghan government proposed that each nation receive a portion of these samples to aid and guide their research programs, and any breakthroughs resulting from said allocations be shared with the rest of the alliance. Dispatched to the four corners of the Periphery via the ORDI's ever-expanding network of Warp Communications satellites, the offer was met with great interest by the regional alliance's five primary members, talks starting all but immediately. Unfortunately for the deal's backers, though the idea behind the offer was acknowledged as sound by all parties, the inducement added to sweeten the pot soon proved somewhat limited in the current era.

    Well aware that Petrusite was a powerful substance with seemingly magical properties for many years, each of the Republic's allies had long ago committed significant resources to tease out its secrets. Unknown to the Republic's government, though incomplete by mid-3049, the Canopian, Taurian, and Capellan research programs had all achieved noteworthy progress towards understanding the volatile material; all three programs were perhaps six months away at most from completion. Intending to bribe their allies with said information in exchange for their meek agreement to the Republic's research deal, the Malkiewicz government instead found its allies willing to push for substantially more and was soon forced to make concessions on multiple fronts. However, though left in a worse position than expected by the time talks concluded, the offer's solid core combined with the pressing need to recover the alliance's technological edge saw all four of the Republic's allies eventually sign on to the deal, only a small number of benefits wrung out of Helghan's allies in exchange for what many in the government viewed as generous gifts of technology.

    Effect
    • Transfer Improved Petrusite Theory to Capellans, Canopians, and Taurians
    • Transfer ERLAMS and Countermissiles to everyone
    • Transfer 1x Major Clan Structure Materials Research Bonus to Taurian Concordat in exchange for the appropriate tech
    • Transfer 1x Major Clan ER PPC Research Bonus to Magistracy of Canopus in exchange for the appropriate tech
    • Transfer 1x Major Pulse Laser, 1x Major Energy Weapons, and 2x Minor Energy Weapons Research Bonus to Aurigan Coalition in exchange for researching Helghan Pulse Lasers chain
    • Transfer 2x Major Battle Armour and 1x breakthrough Clan Double Heat Sinks Research Bonus to Capellan Confederation in exchange for research battle armour chain and double heat sinks
    • +3 influence

    -[X] Build 2 smaller mech factories on Fronc as agreement we made with the planets governments states.
    I can see why you hate this place. - Ania Rameka, FTL message to her partner, Senior diplomat Ulu Rameka

    One part bribe to the planet's inhabitants and one part investment into Fronc's future, January 3049 saw the Helghan Republic follow up on earlier negotiations with Fronc's leaders by agreeing to construct a small mech factory within their nations. Wary of a double cross but equally leery of allowing their on-again, off-again rivals to benefit from their paranoia, Fronc's Canopian and Taurian-descended governments watched with equal parts satisfaction and concern as Helghan cargo ships arrived in-system and made to land; the work crews aboard the unarmed vessels no less apprehensive given the planet's history of conflict. Fortunately for all involved, said work crews landed without incident in early February and immediately began working on their respective factories, the by-now-traditional network of underground tunnels and chambers already halfway complete by the time the year drew to a close.

    Individually smaller than even Detroit's Fisher Industrial Center and quite a bit less efficient in terms of material use and the like, it was an open secret among the Republic's leaders that the planned factories would never equal those within the Republic in terms of output; throughput inefficiencies and the percentage of mechs given to both nations badly cutting into delivery numbers. Worse still, at least from the perspective of the Malkiewicz government's handful of efficiency tsars, the need to build two nearly identical factories resulted in analysts predicting a construction time 50% longer than that of a single, significantly larger factory. However, despite these perceived failings, late December saw the Malkiewicz government pat itself on the back for successfully currying favour with the fractious planet, the Republic promising each of Fronc's governments that their factories would be operational by 3052 at the latest and receiving a substantially warmer response than it had previously enjoyed.

    [Progress: 0/3] → [Progress: 1/3]

    Effect
    • Start work on two factories on Fronc
    • Both governments are warming up to the Republic, but it remains to be seen how they'll feel once the factories are completed.

    Planetary Development:
    -[X] Form The SUP (System Upgrade Program). The SUP is divided into three sub programs, each focused on a broad planetary quality exemplified by the USILR system; one each for Technological Sophistication, Industrial Development, and Industrial Output, with the goal of achieving B rankings in each category. Start Industrial development and output on Rockwellan, Technological development on Cassilda. (3 AP)
    Throughout the nation, countless citizens, forgotten in the political philosophy of the Governments of yesteryear, look to us here and now for guidance and more equitable opportunities to share in the distribution of national wealth.

    On the farms, in the large metropolitan areas, in the smaller cities and the villages, across sixteen planets, hundreds of millions cherish the hope that new energy will replace past tardiness. That the sorrows and tribulations, the wants and fears, will all be forgotten. That the words of our anthem will resonate, clearly and true, from one end of the nation to the other.

    Those millions cannot and shall not hope in vain.

    I pledge you, I pledge myself, to a new commitment to the Helghan people. Let us all, here assembled, constitute prophets of a new order of competence and courage. This is more than a speech; it is a call to arms. Give me your help, not to win votes alone, but to win in this campaign to bring the fruits of the Republic—its liberties, its freedoms, its guarantees—to all who yearn for them.     - Prime Minister Gemini Malkiewicz, extract of their speech to parliament titled "I Pledge You—I Pledge Myself"

    Forever concerned with the well-being of their fellow citizens and keenly aware that they could ill afford to allow the disease of inequality to fester within its borders lest the people rightly revolt, 3049's dawn saw the Malkiewicz government all but brooding in parliament even as the Clans continued their seemingly inexorable advance toward Terra. Elected on a platform of bettering the lives of ordinary citizens and liberating the Federated Suns' Outback, Gemini Malkiewicz and their fellow ministers had ably carried out the latter but found the former to be more time and focus-consuming than anything they had thought possible. Torn between leading their nation through multiple wars and dealing with the seemingly endless litany of issues that arose within the Republic, Helghan's government had spent the years before 3049 delivering only patchwork improvements and focusing on those problems solvable through mega-engineering—a problem which the Republic had all the tools to solve. Recognising this for the lethal combination it could decay into, early February saw a cadre of ministers approach the prime minister with an idea that promised to minimise, if not resolve, many of the government's woes and to do so without compromising the nation's hard-won socialist policies. Dubbed the System Upgrade Program by its theorisers and proponents, the SUP was a program designed to improve the Technological Sophistication, Industrial Development, and Industrial Output of all Republic planets as measured by ComStars' USILR and, in doing so, provide Republic citizens everywhere with good work and better goods.

    Quickly garnering the interest of the Prime Minister before sweeping through the rest of the government like wildfire, the SUP found champions across the length and breadth of Helghan politics; the public and commentariat quickly got in on the action to call for its immediate implementation. Not ones to baulk at a good idea, especially not one that would benefit its supporters to such a degree, the parliamentary wing of the Interstellar Workers Alliance became the program's champions almost overnight. Faced with overwhelming pressure from within and without their party and enamoured with the idea on its own merits, mid-March saw the Prime Minister establish an entire ministry to oversee the program to fruition; the bill to fund and empower it coming noticeably slower once parliamentarians had fully internalised the cost, but coming all the same.

    Dwarfing such entities as the Ministry of Colonisation, the Helghan Bureau Of Ship Procurement, and countless other government departments and ministries, the prosaically named Ministry of Industrial Development was born all but fully formed, such was the support for its existence. Intended to support a population of nearly three billion people spread across sixteen planets, the Ministry of Industrial Development boasted an employee count of twenty thousand a mere week after its formation, the number quickly swelling to ninety thousand as the bureaucratic organ made its first hesitant moves in the world. Taking over an entire skyscraper in Pyrrhus for its headquarters and dozens of other buildings across the Republic, the colossus began planning the first of what its leadership were sure would be many projects as December came to a close, the organisation quietly informing the rest of the government that Rockwellawan would be the first planet in its sights due to its average C-rating among Technological Sophistication, Industrial Development, and Industrial Output metrics and comparatively high population. Given a vast amount of latitude in going about its task and an equally massive amount of resources, the New Year saw the Ministry's plans spin up to speed; Rockwellawan's government told to expect a great many things to occur in 3050.

    Effect
    • -3 AP so long as this program is active
    • One system each turn will experience a random upgrade to one of their Technological Sophistication, Industrial Development, and Industrial Output scores.

    -[X] Construct Planetary Yards on Independence [Progress 0/2] [Action Point Locked Until Completed]
    Warm sand, cold beer, good food, friendly locals, and all we have to do is supervise some bots while they do all the work. Sometimes, I think there really is a god, you know? - Wouter Van der Aart, project manager, morning standup.

    Continuing prior efforts to diversify the Republic's shipbuilding capacity, January 3049 saw the Republic government announce that it would devote substantial resources to building planetary shipyards on the watery world of Independence. Bolstered by a desire to increase the size of the Republic fleet—itself driven by the rapidly worsening Clan Invasion—the bill designed to fund this measure passed through Helghan's parliament with little trouble, its sponsors enjoying a remarkably civil debate period casting votes. Supported by nearly every one of parliament's interest groups and political alliances, the bill's near-frictional passage saw hundreds of millions of Marks turned over to the task, and the workers assigned the task departed shortly after. Arriving over Independence within a month of the decision, hundreds of workers accompanied by thousands of automata descended on the tropical planet like a swarm of locusts, dropships plunging through azure and lapis skies on pillars of flame.

    Starting work from almost the moment booted feet touched sun-kissed sand, only greatly distracted by the beauty of the islands they found themselves on, Helghan personnel threw themselves into the task of building Independence's first ground-based shipyards. Night and day, workers from all across the Republic pushed themselves to their limits, enjoying refreshing cocktails, endless beaches, perfectly formed waves, and countless other pleasures—occasionally pausing their holidays to work on the shipyards that brought them to the planet. Greatly assisted by the flock of machines accompanying the Republic's personnel, warehouses, resource depots, and rail lines seemed to sprout into existence as the year progressed, Independence's largest, most populated, and most industrially developed islands enjoying the sudden surge of work and eagerly awaiting the completion of the shipyards and the accompanying status and jobs. Though the task remained only half-finished by December's close, the shipyards being little more than empty shells and the mag-rail lines disconnected from the planet's industrial output, the sheer speed with which the facilities arose promised a swift conclusion to the effort, the Helghan navy's leadership already dreaming up construction orders for their next batch of warships in preparation for the date they could support them.

    [Progress 0/2] → [Progress 1/2]

    Effect
    • Work begins on planetary shipyards.
    • The working surf has been invented.

    Military:
    -[X] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Can be taken multiple times in a turn]
    -[X] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Can be taken multiple times in a turn]

    Effect
    • +2 Forge Packs

    -[X] Construct a Parthian-class Mobile Shipyard: a set of twelve Jump-Capable shipyard stations carried by a Warp Trader warship, the Parthian is intended to make close to Frontline repair and maintenance easier.

    Effect
    • +1 Parthian-class Mobile Shipyard

    -[X] Construct eight Battlemech Battalions: Task Fisher & Zulim Taw with constructing eight battalions worth of mechs.

    Effect
    • +8 battlemech battalions
    • This brings you to 27 mech regiments and 1 battalion


    Terra Group (Automated):
    [x] Mineral Surveys (Highwater): A world with a history of supplying its Periphery neighbours with ore, Highwater could do with another round of mineral surveys. [Progress: 1/2]

    [Progress: 1/2] → [Progress: 2/2]

    Effect
    • Extensive deposits found.
    • +98,000,000 C-Bills

    Warp Communications Consortium (Automated):
    [X] FTL Comms Expansion. [Progress: 29/80 turns] (+1 AP From Taurian Concordat, +1 AP From Aurigan Coalition, +1 AP From Magistracy of Canopus, +1 AP From Capellan Confederation) [Increased Due To Territorial Expansions]
    [Progress: 29/80 turns] → [Progress: 34/80 turns]


    Helghan Interstellar Scouting & Survey Service (Automated):
    [X] Send out Explorers: The final frontier, one filled with wonder and terror alike, space exploration offers many potential benefits for those willing to risk its hazards.
    Still in the doldrums over last year's failure to find any systems of scientific or political interest to the Republic, the Helghan Interstellar Scouting & Survey Service's executive council made the somewhat surprising decision to double down on exploration efforts; more crews activated, more ships launched, and more systems designated as points of interest as December 3048 rolled over into January 3049. Equipped with navigation charts containing all the latest data—mostly detailing systems of absolutely zero use to anyone—refreshed expeditions set out for destinations throughout the Rimward Deep Periphery, HISSS leadership quietly betting that they'd find one interesting among the howling stars. To the leadership's surprise, the year's end saw them report three things from the deep periphery.

    Eran
    Orbiting its K9V orange main sequence primary at a distance that would ordinarily be quite comfortable for Earth-based life, Eran is something of an anomaly among the worlds of the Rimward Periphery, the Earth-sized rocky planet boasting an axial tilt of well over 80 degrees relative to the plane of the ecliptic. An oddity even within its solar system, Eran's extreme tilt would ordinarily be written off as the result of a catastrophic impact between the protoplanet that would become Eran and another protoplanet several billion years earlier, except that its star isn't quite old enough for the math to work out for Eran to form, hit another protoplanet and have its axis tilted, and resolidify. Regardless of how Eran came to be, HISSS explorers found the world to be one of stark contrasts, orbital mechanics ensuring that, for a significant part of its near two-year orbit, one pole bakes under the sun's glare and the other is a frozen wasteland of never-ending night.

    Despite these harsh conditions, Eran is home to countless unicellular and multicellular organisms that render it a potential colony world. Biochemically compatible with Earth-based life, Eran's native organisms nonetheless take after Helghan's native life in one regard: walking trees and other motile plant life dominate the landscape and provide a scenic—albeit sedate—backdrop to images from the survey crew responsible that discovered it.

    65 Noctuae
    Almost the polar opposite of Eran with its single bright primary and substantial temperature swings driven by orbital mechanics, 65 Noctuae is simultaneously a more and less extreme environment than its sibling in discovery: the dimly lit Mars-sized planet orbiting a brown dwarf that itself orbits a red dwarf. Covered from pole to pole in a sheet of ice fifteen kilometres thick in places, 65 Noctuae would ordinarily be considered a dead world fit only for a waystation were it not for the planet's merely sub-zero temperature and breathable atmosphere—infrared radiation and tidal heating from its brown-dwarf primary keeping Noctuae substantially warmer than its closest analogue, Europa, and maintaining a near perfectly stable temperature throughout. While formal surveys of the planet's expansive subsurface ocean have yet to occur and may not even be possible given its size, predictions suggest that Noctuae's has as much as eight times the water as Independence or Cassilda and depths of up to 180 kilometres, the presence of free oxygen in the atmosphere also suggesting a great deal of life somewhere within.

    Phaethontis
    A thoroughly unpleasant world by most metrics, Phaethontis is the nearest thing to an entirely desert planet as it's possible to get in the universe with desert terrain stretching from its polar oceans to its blast-furnace equator. A little larger than Terra and orbiting a B8V Blue-White Main Sequence star at 90 AUs distance, Phaethontis differs from Republic systems such as Highwater and Caliban in that an intensely volcanic past left it deserts composed of pitch-black, razor-sharp sand grains; sandstorms able to abrade metal and shred meat off the bone. Constantly exposed to a torrent of UV radiation from its primary and featuring a minimum daytime temperature of 30 degrees Celsius at the poles and 80 degrees at the equator, Phaethontis's one redeeming feature is its almost hyperactive oxygen-producing organisms, atmospheric oxygen at 27% despite the limited amount of life present.

    Effect
    • Three valuable systems discovered: Eran, Iono, and Tomul systems
    • Eran is a marginally habitable planet orbiting a main sequence star with an axial tilt of >80 degrees. It is somewhat unpleasant, but home to mobile trees.
    • 65 Noctuae is a frozen world with an interior ocean kept liquid by tidal forces. Interestingly, it has a breathable atmosphere, suggesting autotrophic life somewhere in the depths below its icy shell.
    • Phaethontis is a desert world orbiting a blue-white main sequence star. Unlike the Republic's existing desert worlds, Phaethontis is covered by a layer of night-black volcanic sand and a minimum daytime temperature of 30 degrees at the polar oceans (80 degrees at the equator). The atmosphere is breathable, though.

    Helghan Bureau Of Ship Procurement (BuPro) (Automated):
    [X] Sell Hasta IIIC squadron [Magistracy]

    Effect
    • +6 influence (+2 per Hasta-IIIC)
    Research
    -[X] Long Range Sensors [Progress: 4.8/6]
    [Progress: 4.8/6] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) → [Progress: 6/6]

    Completed!

    The outcome of an unusual alliance between the Republic's spies and astronomers, December 3049, saw long-desired research into advanced sensor technology finally bear fruit for the Helghan Republic, minor breakthroughs in miniaturisation, sensitivity, and manufacturing quality allowing Rockwellawan's little-known Thoran-Cephei Manufacturing Concern to develop a sensor suite of exceptional range and clarity. Heavy and expensive despite the advancements that made them possible in the first place and requiring constant cooling by liquid helium to maintain functionality, Thoran-Cephei's sensor suite combines multiple kinds of telescopes to deliver a ship-scale tool able to track the movement of dropships and eavesdrop on radio calls from the solar system's edge. Forewarned about the product's existence by the company itself and eager to prevent quite so powerful a sensor suite from hitting the open market, the Republic government swooped in at almost the last possible moment and labelled the entire project top secret, compensating the company's staff for their work and dealing with the headache of the security clearances involved. Meanwhile, to assuage Helghan astronomers who were eager to get their hands on long-promised improvements to their equipment and muddy the waters as to what occurred, the Republic released a not-quite-as-powerful version of the system as one part bribe and one part misdirection, the carefully orchestrated misinformation campaign seeming to go off without a hitch.

    Effect
    • Can now build long-range spy vessels/Bug-Eye copies.
    • Bonus to spy satellites effectiveness.
    -[X] High-Gain Transceivers [1.9/10]
    [Progress: 1.9/10] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) → [Progress: 3.1/10]

    -[X] Robotic Workers [1.8/10]
    [Progress: 1.8/8] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) + 0.05 (Taurian Engineering Graduates) → [Progress: 4.05/10]

    -[X] Advanced Fusion Reactor [1/12] (Use: Normal Clan Fusion Reactor Research Bonus (10%) x1)
    [Progress: 1/12] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) + 0.1 (10% Clan Science Instruction) + 1.2 (Normal Clan Fusion Reactor(10%))→ [Progress: 3.5/12]

    Effect
    • -1x Normal Clan Fusion Reactor(10%)
    -[X] Heavy Energy Shield Miniaturization [0.75/2]
    [Progress: 0.75/2] → + 1 (base research) + 1.5 (Advanced Petrusite Theory) + 0.2 (20% ORDI Research Agreement) + 0.19 (Major Petrusite Research Bonus (25%))→ [Progress: 3.64/2]
    Building off of the latest energy shield theories and lent invaluable aid by caffeine, late 3049 saw Helghan scientists accomplish what some thought impossible: mech-scale and below heavy-duty energy shields perfected in the labs of the Karpathian Institute of Technology. A generational leap over existing mech and infantry-scale energy shield systems, these heavy-duty shields can generate a protective forcefield around their operator more than 200% stronger than their nearest competitor and do so with near identical heat, mass, and size profiles. Subject to the same vulnerabilities as naval shields and still vastly weaker by comparison, these shields will help keep Helghan military personnel safe from harm on battlefields across the galaxy as they lead the charge against the Clans.

    Completed with 1.64 overflow!

    Effect
    • -1x Major Petrusite Research Bonus (25%)
    • Can now equip sub-capital craft and infantry with heavy shields
    -[X] Teleportation Theory [0.65/8] (Use: Major Petrusite Research Bonus (25%) x1)
    [Progress: 0.65/8] → + 1 (base research) + 1.5 (Advanced Petrusite Theory) + 0.2 (20% ORDI Research Agreement) + 2 (Major Petrusite Research Bonus (25%))→ [Progress: 6.35/8]

    Effect
    • -1x Major Petrusite Research Bonus (25%)
    -[X] HyperPulse Generator [0.1/20] (Use: Major Hyperpulse Generator Research Bonus (25%) x1)
    [Progress: 0.1/20] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) + 0.5 (Helm Memory Core (Copy)) + 5 (Major Hyperpulse Generator Research Bonus (25%))→ [Progress: 6.8/20]

    Effect
    • -1x Major Hyperpulse Generator Research Bonus (25%)
    -[X] Advanced Warp [0/12]
    [Progress: 0/12] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) → [Progress: 1.2/12]

    [X] Clan Propellants [0/10] [Granted by the Taurian Concordat] (Use: Major Clan Propellants Research Bonus(25%) x1)
    [Progress: 0/10] → + 1 (base research) + 0.2 (20% ORDI Research Agreement) + 0.05 (Taurian Engineering Graduates) + 0.1 (10% Clan Science Instruction) + 2.5 (Major Clan Propellants Research Bonus(25%)) → [Progress: 3.85/10]

    Effect
    • -1x Major Clan Propellants Research Bonus(25%)

    ORDI Research
    -[X] Improved Anti-Gravity Drive [4.8/10]
    [Progress: 4.8/10]→ + 1 (base research) + 0.2 (20% ORDI Research Agreement) → [Progress: 6/10]

    Military Requisition And Design

    News and Rumours
    As expected, the final weeks of December 3049 saw refugee numbers reaching the ORDI's borders tallied at 46.65 million. Accepting the overwhelming majority of refugees out of the alliance's members, the Helghan Republic received well over 25 million new citizens, the Capellan Confederation at second place with only 11.2 million, and the Magistracy of Canopus third at 4.5 million. Provided with more than adequate funding thanks to generous donations from all five of the ORDI's member-states, the ORDIHCR has proven itself able to provide for said refugees, a system once teetering on the edge of collapse running smoothly once more.

    Predicted Refugee Acceptance Breakdown For 3049
    Helghan Republic:     25,250,000
    Aurigan Coalition: 1,700,000
    Capellan Confederation: 11,200,000
    Magistracy of Canopus: 4,500,000
    Taurian Concordat: 3,000,000


    In a rather pleasant turn of events compared to what had come before, Q4 3049 and the completion of the planet's orbiting soletta array saw a sudden spike of optimism ignite across New Oslo, polls reporting a marked improvement in the happiness of the planet's inhabitants and a general sense that things are getting better. Driven by the Republic's suppression of the Brotherhood of the Righteous, the introduction of advanced technologies and medicines, and the gradual but inexorable warming of the planet by the Republic-built solar mirror, the mood among New Oslo's many nations appears genuinely hopeful. While said nations may still be backwards politically and technologically even compared to others in the Periphery, continued education combined with a steady stream of refugees from the Inner Sphere has done much to combat both and Helghan analysts are cautiously hopeful for the future.


    Of great interest to those scientists in the galaxy who specialise in the subject but to the incredible disgust of those affected by it, mid-July saw a planet-wide mass spawning event by the planet's iconic squid analogues—locally dubbed Ika—that left much of Charybdis at a standstill. Though most of Charybdis' land masses remain uninhabited due to the system's sub-seven million population, the sheer scale of the event saw the coastlines of several cities swamped by a tide of tennis ball-sized eggs so thick that the water acted more like a gel than a liquid and the gelatinous packages turned the waters offshore an inky black. Slowing shipping until the start of October, the once-in-a-generation event—according to local scientists—triggered a minor downturn in the fortunes of businesses reliant on water-based shipping and an incredible upturn in the fortunes of creatures, including Republic gourmands and Ika, seeking to eat squid eggs.


    Aurigan Coalition
    Continuing the labours of past years with verve, 3049 saw the Arano government's program to sweep Panzyr's sky free of junk go from strength to strength as increasingly adept systems and personnel captured and disposed of the deadly material in ever-increasing amounts. With the Coalition releasing second-generation versions of those same systems partway through the year to wide acclaim from the populace below, the sight of collected junk burning up in Panzyr's atmosphere became almost mundane to the planet's inhabitants, so substantial were the quantities. Similarly, Kamea Arano's multi-million C-bill grant program has had quite the impact on the health of Panzyr's economy, with analysts from governments and private businesses alike awarding it a gold star. While Panzyr's industrial sector still lags behind those of other systems as a result of its unique orbital hazards, its less-material businesses are not merely keeping pace with their competitors elsewhere but are swiftly garnering respectable reputations thanks to the infusion of capital delivered by the grants; Echural, Pixel Pulse Entertainment, and Anima Bio Genetics just three of many Panzyr born and bred corporations.


    Building off of earlier reports, mid to late 3049 saw the Aurigan Coalition sign several additional trade deals with the government of Herotitus, the independent system no doubt eager to diversify its tourism-based economy in the wake of recent downturns caused by the Magistracy's relative prosperity. Though minor compared to those deals that exist between the Coalition and its allies across the Periphery, these agreements have already reportedly brought in a much-needed influx of liquidity for the cash-strapped locals, the planetary government broadcasting that fact far and wide across Herotitus according to ComStar's news service. Despite only being signed in early August, the local populace has already responded positively to the news, with approval of Lady Kamea Arano and her nation shooting up from "literally who?" to mildly positive, a good sign considering that the move appears to be part of a long-term plan to draw the system into the Aurigan Coalition as a full member.


    AC researches Primitive Pulse Lasers (Helghan) and shares with the rest of the ORDI. [EDITED IN POST FACTO]

    Primitive Pulse Lasers (Helghan)
    NameTypeHeatDamageRangeTonsCritical Slots
    Primitive Small Pulse LaserEnergy233/6/911
    Primitive Medium Pulse LaserEnergy474/8/1221
    Primitive Large Pulse LaserEnergy10105/10/1552

    Effect
    • Aurigan Coalition develops and shares Primitive Pulse Lasers (Helghan) technology


    Magistracy of Canopus
    Much to the relief of fans throughout the Rimward Periphery, Hardcore's Professional Combat Association once more proved able to put on the gladiatorial mech games that have proven so popular, hundreds of millions tuning in to distract themselves from the increasingly grim situation in the Inner Sphere. Featuring a larger than usual percentage of up-and-comers due to the sheer number of past participants who have joined the militaries of their respective nations, the games themselves proved no less exciting for the loss of experience and, according to die-hard enthusiasts, the infusion of new blood seemed to add vivacity to the sport that will no doubt spice up future tournaments. The most popular season yet, several major Inner Sphere media conglomerates have reportedly entered negotiations with the PCA to carry future seasons, and various lifestyle companies have reached out to the first, second, and third-place winners to secure sponsorship deals.

    Speaking of winners, the overall winner of the 3049 Hardcore Games was the Taurian MechWarrior Bunny Giménez. The pilot of a heavily modified Crusader heavy mech and co-owner of the Maricopa Maven stables, Bunny Giménez, beat out the Helghan Constantin Riber and Canopian Aubrianna Stone to claim the championship cup. Though their 800,000 and 500,000 C-Bill consolation prizes, newfound fanbases, and sponsorship deals undoubtedly softened the blow to their egos somewhat, Riber and Stone have promised to return to challenge Giménez for the cup next year. Naturally, the PCA has already begun promoting the promised clash as a must-see grudge match.


    Taurian Concordat
    To the distinct pleasure of those responsible for organising the deal in the first place, December 3049 saw the Taurian Concordat inform its allies that its researchers made several impressive breakthroughs in the material sciences as part of the ORDI's ongoing research efforts. Supported by their counterparts in the Republic, Coalition, Magistracy, et al., Taurian scientists succeeded in developing a number of manufacturing processes and materials which could be revolutionary if utilised correctly, said scientists putting their money where their mouths were by showcasing a never-before-seen composite for use in place of the foamed aluminium traditionally used in battlemech chassis. Though more fragile than an equivalent mass of endo steel due to the substance's different mechanical properties, the highly advanced Taurian composite boasts a strength-to-weight ratio such that a mech design does not have to choose between lighter weight and more space; the option of having one's cake and eating it, too, finally available to the alliance's mech designers.

    Effect

    • Taurian Concordat develops and shares Composite Internal Structure tech


    In a sign of the Taurian Concordat's good intentions towards those systems claimed from the Federated Suns—or reclaimed, depending on who you ask—mid-March saw the Concordat negotiate for and secure the purchase of three Horus-class mobile factories from Pharaoh Automated Solutions. Older, cheaper, and somewhat less capable than the newer Mark IIs, PAS' original mobile factories are nonetheless more than up to the task of bulk infrastructure construction on undeveloped worlds, the Taurians no doubt counting on this fact. After arriving in Concordat space in May, the titanic machines passed handoff checks by June and were redeployed to the Pleiades Cluster alongside numerous other workers and machines. Descending on the hundred or so systems of the cluster with construction on their minds, the army of labour immediately began building rail lines, highways, powerlines, and countless other simple but invaluable things across the cluster, the three machines and their retinues greatly easing the lives of those living there.

    However, despite the substantial investment such a deployment represents for the Taurian Concordat and the region's people, its comparatively limited scope combined with the natural ravages of time have conspired to smudge the lustre of Concordat membership. Though most Helghan politicians would no doubt kill, or at least maim, to have approval numbers as high as the Concordat enjoys in the former Outback, rumours and reporting suggest that a certain cynicism has begun to set in over just when the promised and long-desired freedoms guaranteed by the Concordat Charter will arrive in the Outback. No doubt well aware of this, Helghan analysts suspect that the newly elevated Protector Edward Calderon will make some manner of move in 3050 to address said concerns.


    Capellan Confederation
    Representing another victory for those involved in organising the original Outer Rim Defence Initiative's joint research program, late November saw Confederation scientists complete their work towards miniaturising capital-scale laser systems; the test-firing of the smallest variant successfully intercepting a drone target and evaporating it with a single blast. Heavily based on the capital lasers of warships, the newly dubbed sub-capital lasers are smaller, lighter, produce less heat when fired, and are far more accurate against sub-500-ton targets than their progenitors, their downsides being lessened power and range due to the compromises required to reduce their size. Though it took many months of continuous effort to achieve and a great deal of funding on the part of the Confederation, the development of these weapons—and their sharing among the ORDI—gives ship designers across the alliance access to a valuable middle ground weapon between conventional lasers and their capital-scale alternatives.


    No doubt a direct result of the Clarion Cry's effectiveness against the Smoke Jaguars early in the year, December's first week saw the Capellan Confederation inform its allies that it had begun work on an ultraheavy vehicle of its own design. While information on the proposed ultraheavy remains scarce due to the project only being in its early days, reports from the Confederation combined with supposition from Republic military analysts well versed in such matters suggest that the Confederation is seeking to build a kind of ultraheavy hovertank to aid its armed forces when it comes to taking cities against entrenched foes. Given the current state of Capellan industry and the nation's inexperience with building ultraheavy craft, those same analysts also believe that the design—whatever it may end up being—will almost certainly mass under 50,000 tons and launch sometime in 3050.

    Effect
    • Capellan Confederation develops and shares Sub-Capital Lasers technology

    CC researches and shares Basic Battle Armour technology with the ORDI [EDITED IN POST FACTO]

    Basic Battle Armour
    As per normal design rules... but you can only build light and medium BA designs. I haven't settled on how many you can field, but it'll be a fraction of your PA(L) budget, so don't go thinking you'll ever get divisions of Battle Armour.

    Effect
    • Capellan Confederation develops and shares Basic Battle Armour technology

    Federation of Autonomous Systems
    In a positive development for the Federation of Autonomous Systems, the year's second half saw police forces within the rapidly coalescing state track down one of the five remaining members of the corruption ring whose efforts had scandalised the nation some months prior. Initially thought to have fled the Federation alongside his four compatriots, the former director of Mandaree's planetary sanitation service, Scott Viliame, was tracked by Federation police to the Taygeta system, where they arrested him as he waited for a connecting JumpShip to Cumberland. While the man only had a few hundred thousand Helghan Marks on him, most of which were in the form of high-denomination bills, backtracking revealed that he had visited Taygeta's planetary HPG within hours of his arrival and a thorough investigation of his belongings uncovered several standard-issue credit chits sewn into the linings of his trousers and jackets.

    Unable to access the accounts tied to the credit chits without ComStar's assistance and suspecting they contain more of the nation's stolen wealth, Federation police are currently working to secure the interstellar organisation's cooperation. As one of the Federation's backers and holding a vested interest in seeing it thrive, the Republic has naturally already communicated to ComStar its interest in seeing justice done.


    United Rimward Collective
    In almost studied contrast, 3049 has seen the situation in the United Rimward Collective go from bad to worse, with the year's end seeing the first hints of violence emerge in the nation. According to reports from a steadily dwindling number of reliable news services and a seemingly ever-increasing number of peacekeepers, well-known figures associated with Marxist and neo-Jacobinist groups within the Collective were the targets of harassment by supporters of their opponents—some attacked in the street, others while giving interviews, etc. Though said violence has thus far been limited to pushing, shoving, and the occasional punch, it presents a worrying trend only limited by the fact that less physical harassment has already seen many Marxists flee for the safety of Firgrove and the fact that Helghan peacekeepers are ready to stop larger actions.

    Speaking of Firgrove, the same period has seen interest in seceding from the United Rimward Collective continue to grow; supporters of the idea wish to join the Federation of Autonomous Systems instead. A rather extreme solution to the problem, some Helghan analysts have nevertheless begun to consider the possible ramifications and have cautioned the Republic's government to at least consider the idea lest the situation in the Collective continues its downhill slide.


    ORDI
    As per their agreement with the Helghan Republic, 3049 saw the Outer Rim Defence Initiative's member-states carry out extensive counter-intelligence sweeps in exchange for the secrets behind Petrusite Synthesis, both sides ultimately coming away happy with the deal despite worries on the Republic's end over giving away its Petrusite monopoly.

    Concerned over infiltration by foreign agents, the Republic's fears were somewhat alleviated after its allies' security sweeps picked up a goodly number of operatives, the Taurian Concordat boasting the most—the majority of whom were present on newly absorbed systems in the former Outback—and the Aurigan Coalition the least. Primarily embedded in harmless positions and having only small networks of patsies, these agents belonged to everyone from the Lyran Commonwealth to the Federated Suns and appeared tasked with simply gathering information on the ORDI rather than anything too nefarious. Currently being tried for espionage, the captured operatives will likely prove valuable bargaining chips in return for any ORDI agents captured by foreign states. Of those agents utilising advanced biotechnology, there are no signs of infiltration despite an enthusiastic investigation by the relevant authorities. However, recent speculation suggests they may have a Clan origin despite the steadfast disagreement of the ORDI's Clanner POWs.

    For their part, 3049's end has seen all ORDI states, bar the Helghan and Alphard Republics, complete work on Petrusite Synthesis plants. Vast structures of pipework, high-pressure containment vessels, electric furnaces, and irradiating substances, heavy investment by those states involved saw the gargantuan synthesis plants appear at almost unbelievable speeds; empty tracks of land transformed into vital facilities almost overnight. Able to produce a few hundred units of Petrusite per day thanks to the recently developed Kovačević-Mei process, these synthesis plants simultaneously reduce the value of Helghan as a military target and enable the Republic's allies to more easily carry out their own research into Petrusite products without having to carefully husband supplies obtained from Helghan.


    Lyran Commonwealth
    To the surprise of absolutely no one, the Clan Invasion of the Lyran Commonwealth has seen the health of the nation's economy decline sharply, with consumers growing more uncertain and less willing to spend Kroner with each passing month. Driven by the continued loss of territory to the Clans and the growing fear of their approach, this unease has led economic analysts throughout the galaxy to consider the almost unprecedented move of downgrading the Commonwealth's economic rating and labelling it an economy in recession. No doubt seeking to head these issues off at the pass, mid-June saw Archon Melissa Steiner announce a raft of measures designed to keep the Lyran economic machine up and running; the passage of the bills through the Estates General greeted with a tepid, but not negative, reaction. While only time will tell if the Commonwealth will be able to shrug off this economic decline, the proximity of its industrial heartland to the Clans' frontlines suggests that the future may not be as rosy as the Archon would like.


    In related news, October 3049 saw the Steiner government announce a series of war bonds to support the LCAF during the Clan Invasion, and citizens of the Lyran Commonwealth were encouraged to purchase the bonds as part of their patriotic duty toward the nation. Selling for as little as 20 Kroner and set to mature in ten years, these bonds would see the Lyran Commonwealth payout 26 Kroner to the bondholder for every 20 Kroner worth of bond purchased. Undoubtedly a result of the Archon seeking to avoid raising taxes and, thus, the ire of her subjects, these war bonds have already proven popular with the Lyran public, with many millions of C-Bills worth sold in the first weeks of their introduction thanks to widespread advertisement campaigns involving Lyran holovid stars, musicians, and other celebrities.


    According to reports from those few Republic spies operating in the Lyran Commonwealth, the year's closing months saw a handful of LCAF facilities on Tharkad, Eutin, and Tetersen all undergo a sudden and dramatic upgrade to their required security clearances; grumbles from the facilities' staff reaching the ears of ORDI personnel despite the limited network of catspaws and gossips they operated. Already secure facilities in the sense of being military-owned and operated, the sudden change in status triggered some confusion among Helghan analysts until one particularly observant member discovered evidence hinting that said facilities were receiving nuclear munitions from the Commonwealth's extensive stockpiles. Initially believing that these locations represented secondary assembly plants for Lyran-assembled, FedSun-made bomb-pumped lasers, subsequent investigation now suggests that they are instead manufacturing sites, the Lyran state having seemingly reverse-engineered FedSun BPLs for their own use. Though Helghan analysts have been quick to warn the nation's leaders that the Commonwealth will likely need to lean on the FedSuns for additional BPLs for some time, the mere fact that the Commonwealth appears to have an independent source of the devastating weapons may offer the ORDI a unique opportunity in the future...


    Federated Suns
    Continuing the trend of research and development, Helghan operatives within the Federated Suns have recently uncovered evidence suggesting that the nation has notably furthered its understanding of Petrusite over the past year. According to surreptitiously copied files transmitted back to the Republic, the Federated Suns' scientific body now has an understanding of Petrusite theory on par with that of the Republic circa the 3030s, and rumours suggest that it has already begun experiments on Petrusite synthesis. A worrisome trend considering the sheer power and utility of Petrusite, various figures within the Republic's intelligence community have warned that keeping an eye on this area of FedSun science is vitally important.
    In substantially less concerning news, the same period saw FedSun corporations unveil their latest generation of anti-gravity drives to an impressed public. Worse in all regards to what the ORDI's various member-states are using, these new anti-gravity drives are nonetheless sufficient to grant FedSun AFS superior manoeuvrability against those lacking the devices and will doubtlessly see widespread use in consumer products.


    To the surprise of ORDI military personnel, who have grown somewhat used to the slow and steady ways of the Inner Sphere's military procurement system, 3049 saw the Armed Forces of the Federated Suns unveil several new mech designs throughout the year. While the FedSuns have thus far refrained from sending out detailed info packets to their enemies and rivals, images broadcast by FedSun news services and conversations overheard by ORDI spies have made clear that the Suns have developed a set of 40-ton, 70-ton, and 100-ton mechs to augment their existing forces. Publically named the Comet, Chieftain, and Challenger, all three mech designs appear to make heavy use of autocannons to deliver high levels of damage very quickly and appear set to become mainstays in the AFFS.


    Free Worlds League
    As expected by some of society's more cynical members, the Clan Invasion of the Inner Sphere has proven to be a great blessing to the Free Worlds League's armament industry, the nation's neighbours desperate to secure additional supplies of expendables and willing to pay top dollar for it. Selling to the Draconis Combine and Lyran Commonwealth alike, 3049 saw Free World League corporations post record profits as their increasingly productive factories churned out guns, ammo, and spare parts in job lots, a river of goods to rival the Helghan Republic's flowing coreward. While Thomas Marik has undoubtedly ensured that the League military has the pick of the output, the sheer quantity of material sold has filled the state's coffers sky-high and bought the Captain-General a great deal of respect from the more budget-conscious members of parliament.


    In technology news, 3049 also saw the Free Worlds League unveil its latest generation of Warp Drives to the galaxy. Worse than those in use by the Helghan Republic and Capellan Confederation, League warp drives are nonetheless the most advanced in use within the Inner Sphere and promise to give the League a leg up on its rivals when it comes to trade and war.


    Draconis Combine
    Broadcast throughout the hundreds of solar systems making up the Draconis Combine and reaching the rest of the galaxy courtesy of ComStar, the final weeks of December 3049 saw the state funeral of Coordinator Takashi Kurita take place on Luthien despite the recent attack by Clans Jade Falcon and Nova Cat; hundreds of billions of people bearing witness as an ox-drawn cart carried the imperial coffin from the site of the former monarch's death outside the gates of the Imperial Palace to the mausoleum within the palace complex. Headed up by a battalion each of the Otomo and Izanagi Warriors in their mechs, the eight-kilometre-long funeral procession—consisting of a herd of sacred cows, 30,000 mourners from the palace staff and imperial government—marched the entire distance from the palace's entrance to the Coordinator's final resting place, their path through the palace's main concourse taking them under the swaying boughs of cherry trees and illuminated by iron braziers. Though the final internment of the former monarch's body in the imperial mausoleum was, naturally, hidden from the public's eye, Coordinator Theodore Kurita's pledge that the Combine will have its retribution on the Clans was very much not, his speech reportedly playing across the nation for weeks after the event concluded.

    No doubt a concession to the public caused by the sheer amount of damage done to Luthien's Imperial City by the invading clans, the unprecedented decision to broadcast images of the Imperial Palace represents a significant break in tradition for the normally ultra-conservative state, and Helghan analysts have already begun pondering what it could mean for the future. Loathe to speculate without more information, said analysts have yet to come out with official reports for the nation's lawmakers.

    Faction Popularity and Issue Changes
    All Factions: +15% popularity (temporary)


    Influence Changes
    -1.25 (ORDI Research Agreement)
    +3 (base/year)
    +4.85 (factions)
    +3 (ORDI Research deal)
    +6 (BuShips)

    Total: +15.6 influence

    One-Time C-Bills Changes
    +98,000,000 (Highwater Minerals Exploration)

    Total: +98,000,000 C-Bills

    Updated Info Posts
    Helghan Republic

    The Lords of Ruin -- Battletech/Killzone Crossover

    Helghan Republic: Current Date: 3050 General Stats: Population: 3.70 Billion Recruitable population: 35.3 million out of 37.0 million. Stability: 99% War Support: 83% Recruitable Pop Percentage: 1% Action Points: 18 (+2 from Spencer and Cassilda joining when High-Gain Tranceivers is...
    forums.sufficientvelocity.com

    Helghan Republic Order of Battle

    The Lords of Ruin -- Battletech/Killzone Crossover

    Helghast Order of Battle: Doctrine: Super-mobile blitzkrieg doctrine based around deploying divisions via ship-based dropships and cruisers. Navy...
    forums.sufficientvelocity.com
     
    Last edited:
  • View discussion
    • The Clan Invasion -- January-March 3050 Actions
  • View content
    • Running With the Wolves
    Triggered by the decision of Jamie Wolf and company to make ready to journey to the Free Rasalhague Republic, 3049's final weeks saw the member-states of the ORDI locked in fierce debate over whether the interstellar alliance should permit such an act. When questioned as to why they would want to head Corewards, the Dragoons' leadership repeated the explanation that they had offered favourable terms to fight on the beleaguered state's behalf with the proviso that they be first pit against the forces of Clan Wolf to resolve a matter of honour. Quite a generous offer—and quite a valuable one, too—given the Dragoons' size and abilities, many within the ORDI found themselves viewing the offer in a less-than-generous light under recent circumstances; some among them going so far as to obliquely suggest that the preparations for a Corewards journey were little more than an attempt to rejoin their allies among the Clans. Considering themselves to be realists, these cynics made clear their preference for the Dragoons to stay where they are in the Brighton system, any diplomatic problems created by such an act outweighed by the security gains which come from not having to allow the Wolves to return to their allies with valuable technology and knowledge.

    On the opposite end of the scale, others within the ORDI—primarily those who had fought the Clans before rotating back for much-needed R&R or convalescence—made clear their view that the Dragoons' could be trusted. Citing the by-now well-known importance of honour to Clan society, the Clanners' relative lack of guile, and what knowledge has been gleaned regarding Clan Wolf's internal politics, these people argued that the Dragoons could be trusted to fight against the Invading Clans with all they have and that there was almost no chance that they would switch sides or attempt to escape the Inner Sphere. Building off this view, many of those involved argued that the Dragoons should be permitted to leave, while a small minority even suggested using the ORDI's Command Circuit to get them to the front faster.

    With a divisive set of options to argue over, the debate between ORDI governments proved intense and rapid. The Aurigan Coalition and Magistracy of Canopus, wary of exposing a vital supply line to the Wolves, indicated their support for the idea of letting the Dragoons go to the front using their own JumpShips: the ORDI's COmmand Circuit off limits to the ostensible mercenaries. Meanwhile, the Capellan Confederation surprised many by making clear its intentions to hurry the Dragoons along, its leader, Tormano Liao, apparently willing to gamble that the Dragoons would fight against the Clans with all their might. Finally, the Concordat government announced that it approves of letting the Wolves go, but doesn't care how they get there, the other ORDI states marking it down as a functional abstention under the circumstances.

    Current Voting Intentions
    Let The Wolves Go: Aurigan Coalition, Magistracy of Canopus
    Speed the Wolves Along: Capellan Confederation
    Forbid The Wolves From Going:
    Abstain: Taurian Concordat

    How does the Republic vote?
    [] Let The Wolves Go
    [] Speed the Wolves Along
    [] Forbid The Wolves From Going
    [] Abstain
    [] Write-in.

    Who does the Helghan Republic attempt to sway to support their vote, and how hard do they try?
    [] Taurian Concordat [-5 influence]
    [] Taurian Concordat [-10 influence]
    [] Taurian Concordat [-15 influence]

    [] Magistracy of Canopus [-5 influence]
    [] Magistracy of Canopus [-10 influence]
    [] Magistracy of Canopus [-15 influence]

    [] Aurigan Coalition [-5 influence]
    [] Aurigan Coalition [-10 influence]
    [] Aurigan Coalition [-15 influence]

    [] Capellan Confederation [-5 influence]
    [] Capellan Confederation [-10 influence]
    [] Capellan Confederation [-15 influence]



    The Precentor-Martial's Shopping List
    Informed as to ComStar's interest in acquiring a vast supply of arms in late 3049, January 3050 saw the Republic's government finally begin to move on the matter with a series of HPG-mediated meetings between Precentor-Martial Anastasius Focht and high-level Republic diplomats occurring in the first weeks of the new year. Kept out of the news cycle out of respect for ComStar's prior neutrality and the request of the Primus himself, said meetings saw the newly-named Precentor-Martial unload an almost unbelievable wishlist onto the Republic as part of a plan to prepare for the Clans' potential arrival on Terra; the Precentor helpfully separating his requests into three cumulative tiers of increasingly powerful technologies. Separated by some esoteric measure of power, political sensitivity, and utility that made little sense to anyone outside of the Republic's military, each tier presented to the Republic's negotiators came with it a commensurately large prize, the notoriously stingy and wealthy ComStar happy to spend C-Bills when it comes to the defence of their headquarters and humanity's shared home among the stars.

    Tier One
    The first tier of exchange proposed by Anastasius Focht and his staff, the proposed tier would see the Helghan Republic supply ComStar with a vast supply of conventional arms, armour, and ammunition. Ranging from infantry equipment (gauss assault rifle, heavy support weapons, etc.) and combat vehicle equipment (H-Lasers, H-Autocannons, etc.), to specialist ammunition (varied) and ground automata, this tier appears aimed at allowing ComStar to outfit its conventional infantry and vehicle forces as best as they can. Requesting an eye-watering amount of rather traditional equipment compared to arms deals the Republic has made with other Inner Sphere powers—ComStar listing enough gear to supply multiple divisions—the quasi-religious order is offering to pay the Republic an astounding 750,000,000 C-Bills in exchange.

    Tier Two
    Coming off strong with their tier one offer, Anastasius Focht's tier two purchasing plan offers an absurd 1.5 Billion C-Bills in exchange for: everything already proposed in tier one, Extended Range anti-missile-systems, Helghan power armour suits, high-grade cybernetics (the same kind used in Helghan special forces), Aerospace fighters (multiple varieties), advanced mech components (DHS, Ferro-Fibrous armour, etc), and ECM gear. As with tier one, the quantities requested are extreme compared to earlier deals made by the Republic, with ComStar seemingly trying to buy itself a military in a single go.

    Tier Three
    As with tiers one and two, tier three of Anastasius Focht's armament plan did not lack ambition or scale; ComStar's general putting in papers for a frankly absurd quantity of equipment. Aside from requesting everything included in tiers one and two, tier three saw ComStar offer to purchase from the Helghan Republic: sub-capital weaponry (lasers, missiles, autocannons, etc), capital weaponry (lasers, missiles, autocannons, etc), drone ASF, advanced fusion engines, anti-gravity systems, and null-signature systems. Naturally, ComStar offered to pay an astounding 3 billion C-Bills in exchange for this tier of items.

    Which Offer, If Any, Does the Republic Accept?
    [] Tier One
    [] Tier Two
    [] Tier Three
    [] Write-in
    [] Reject all offers


    Actions
    You have 7 out of 10 Action Points to spend. -1AP from Tikonov Command Circuit rental. -1AP from Free Worlds League Command Circuit rental. -1AP from Trinity League security force commitment.

    This list of available actions is by no means exhaustive, so feel free to suggest more actions or variations on the actions listed below.

    Federated Suns:
    [] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Stage diplomatic incident [Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/12 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Continue NAIS Infiltration [Medium-Hard]: Continuing prior efforts to infiltrate the New Avalon Institute of Science is vital if we want access to their latest designs and most secure production sites.
    [] Steal research [Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Infiltrate Davion Palace [Hard]: By infiltrating the Davion palace, we can gain access to its most vital secrets and most important people.
    [] Write-in:

    Lyran Commonwealth:
    [] Expand Lyran intelligence network: Having placed a large number of agents within the lower levels of Lyran society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Medium]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Steal research [Very Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Very Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]

    Free Worlds League:
    [] Expand League intelligence network: Having placed a large number of agents within the lower levels of League society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Hard]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Extremely Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in (Convince me you've got something good)

    Draconis Combine:
    [] Arms Sales: With the Combine now at war, they may be willing to purchase items up to and including formerly LosTech ammunition from the Republic. Given the distances involved, such shipments will be very difficult until efforts are made to improve the backend logistics. [-5 influence]
    [] Tech for Tech: By offering the Combine information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.
    [] Expand Combine intelligence network: Having placed a number of agents throughout Draconis society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Impossible]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-15,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in

    Trinity League:
    Unrest in the Former Trinity League: Low
    League Self-Governance: None
    [X] Commit Security Forces: Once the responsibility of those the Republic has since ousted/bribed to leave, the former Trinity League is bereft of security forces. Temporarily deploying Helghan security forces, while only a stopgap, will almost certainly help local police keep a handle on things. [Progress: 1/3]
    [] Republic Planetary Militia: Devastated by the ousting of the ex-CCAF-turned-pirates-turned-warlords, the planetary militias of the former Trinity League are in no position to fend off even the weakest pirate raid. Rebuilding these militias with Republic stockpiles, while a distraction from the Rasalhague front, will give it substantial influence over them. [Progress: 0/2]
    [] Fate of the Trinity League (Write-In): With the former rulers of the Trinity League either deposed or enjoying a relaxing vacation with their newfound wealth on the planet of their choosing, the question remains "What does the Republic wish to do with the systems of the former Trinity League?" [Note: This will unlock further options depending on what you do]

    Capellan Confederation
    [] Tech for Tech: By offering the Confederation information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.

    ORDI Actions
    [] Write-in

    Helghan Republic
    [] Establish Battle Armour Production: Requiring many specialist components and manufacturing processes to construct and support, the deployment of battle armour to Republic units will require the creation of dedicated manufacturing centres and logistics pathways before it is practically feasible on any scale.
    [] Construct a military defence station over [LOCATION]
    Locations available:
    • Cassilda
    [Can be taken multiple times in a turn]
    [] Upgrade a military defence station at [LOCATION]
    • Available stations:
    • Caliban (Medium → Large)
    • Charybdis (Medium → Large)
    • Highwater (Medium → Large)
    • Mir (Medium → Large)
    • Tiverton (Medium → Large)
    • Contrilla (Small → Medium)
    • Detroit (Small → Medium)
    • Mantharaka (Small → Medium)
    • New Oslo (Small → Medium)
    • Rogue (Small → Medium)
    • Spencer (Small → Medium)
    [Can be taken multiple times in a turn, but you can only upgrade a single station once per turn]
    [] Construct a Petrusite synthesis plant on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Helghan
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]
    [] Construct a secondary fleet anchorage on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]

    Military
    [] Raise an Army: Task your military with forming an additional army. [Progress: 0/2] [Can be taken multiple times in a turn so long as there is recruitable population remaining]
    [] Construct two Hasta-class cruiser Squadrons: Task your shipyards with constructing three Hasta Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIIC-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIIC Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIID-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIID Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct one Noctis-class cruiser Squadrons: Task your shipyards with constructing six Noctis Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Damascus-Class Carrier Squadron: Task your shipyards with constructing a squadron of Damascus-Class Carriers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Toxotai-class Guided Missile Cruiser Squadron: Task your shipyards with constructing a squadron of Toxotai Guided Missile Cruisers. [Progress: 0/3] [Can be taken up to four times in a turn]
    [] Construct 4 Guardsman-class Pocket Warships: Task your shipyards with constructing 4 Guardsman-class pocket warships. [Can be taken multiple times a turn]
    [] Construct a Pilum-class Battlecruiser squadron: Task the Detroit shipyards with building a squadron of three Pilum-class battlecruisers. [Progress: 0/6] [Cannot construct other 1m+ ton designs until completed]
    [] Hecatoncheires-class Escort Carrier Squadron: Task your shipyards with constructing a squadron of Hecatoncheires-class Escort Carriers. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a MAWLR-II pack: Task your heavy industry with constructing a pack of three MAWLR-IIs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a SAHLR pack: Task your heavy industry with constructing a pack of three SAHLRs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Hydra pack: Task your heavy industry with constructing a pack of three Hydras. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Dragon pack: Task your heavy industry with constructing a pack of three Dragons. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Pyrrhus pack: Task your heavy industry with constructing a pack of three Pyrrhuses. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct 2 Battlemech Battalions: Task Fisher & Zulim Taw with constructing 2 battalions worth of mechs.

    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship :V)

    Support Modifiers
    Navy    :
    • +2 (Make-Do Yardships)
    • +3 (Tsitsang Fleet Anchorage)
    • +5 (Decreased Distance)
    • +2 (Parthian-class Mobile Shipyard)
    • -2 (ORDI Donation)

    Ground Support Capacity:
    • +1 (Tsitsang Ground Facilities)
    • +0.25 (Fort Loudon)
    • +0.50 (Decreased Distance)
    • +1 (Forge Pack)
    • +0.50 (Forge Pack)
    • +0.25 (Forge Pack)
    • -1 (ORDI Donation)
    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 11/16 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 2.4/3.25 [Base: 0.75] (use the transport size value)
      Navy (11/16 Naval Support Capacity)
      • 8 Noctis Frigates (8 capacity)
      • 1 Noctis Frigate (1 capacity) [60% health]
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 27 Commissar-B Pocket Warships (0 capacity)
      Ground (2.4/3.25 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight) [85% health]
      • 0.5 of Fourth Division, First Army (0.25 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [80% health]
      • 3 Forge Packs: ETA: Q1 3050 (0.0 Weight)
    • Navy
      • 1 Carson II-class Frigate (1 Capacity)
      • 2 Carson II-class Frigate: ETA: Q1 3050 (2 Capacity)
      • 1 Carson II-class Frigate [50% capacity] (1 Capacity)
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF) [Q1 3050]
      • 2 Armoured Regiments [Q1 3050]
      • 2 Infantry Regiments [Q1 3050]
      • 4 Armoured Regiments
      • 6 Infantry Regiments
    • Navy
      • 1 Auroch-class Frigate (1 Capacity)
      • 2 Auroch-class Frigate en route: ETA: Q1 3050 (2 Capacity)
      • 1 Auroch-class Frigate (1 Capacity) [65% health]
      Ground
      • 3 Combined Arms Brigades
      • 1 Combined Arms Brigades [Q1 3050]
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 5 Armoured Regiments
      • 10 Infantry Regiments
      • 2 Armoured Regiments [Q1 3050]
      • 4 Infantry Regiments [Q1 3050]
    • Navy
      • 1 Halcon-class Destroyer (1 Capacity)
      • 2 Halcon-class Destroyers: ETA: Q1 3050 (2 Capacity)
      Ground
      • 1 Mech Regiment
      • 2 Armoured Regiments
      • 2 Infantry Regiments
      • 2 Superheavy Gunships
      • 1 Superheavy Gunship [Q1 3050]
      • 1 Armoured Regiment [Q1 3050]
      • 2 Infantry Regiments [Q1 3050]


    [] Prioritise Naval Supplies: By prioritising the shipment of naval supplies over those for ground troops, we can further improve our ability to deploy naval forces to the Outback. [+1 Naval Support Capacity, -0.125 Ground Support Capacity]
    [] Prioritise Ground Supplies: By prioritising the shipment of supplies for ground troops over those of the navy, we can further improve our ability to deploy ground forces to the Outback. [+0.25 Ground Support Capacity, -0.5 Naval Support Capacity]
    [] Operation Santiago Phase 5 Objectives (Failure to detail new objectives for Operation Santiago will have me pick ones based on prior discussion) [You can have a max of 300 words and 2 if statements in this action.]

    Military Requisition And Design
    You have 4 out of 4 Requisition Points to spend on upgrading Helghan's ground forces. These upgrades are given to all active armies at once, though the more armies you have the longer it'll take to roll out changes.

    Requisition
    [] Primitive Pulse Laser Systems: Inspired by examples from the Star League and optimised using technology collected from the battlefields of the Clan Invasion, ORDI pulse laser systems are broadly competitive with their Clan counterparts and will do much to preserve the technology gap between the two powers.

    [] HSA-49 'Skandia' Gauss-Powered HMG: Both named in celebration of the (in)famous victory on Skandia during Clan Invasion, and as a sign of respect for the personal bravery in the face of near certain death of Clan Smoke Jaguar's warriors, the Skandia Gauss HMG was released for mass production and distribution to both the Republic's regular armies and National Guard units. Designed by Helghan State Arms initially as a crew-served weapon, even with PAL, a tripod mount would have been required to achieve firing stability. However, with the creation of the Republic's first native BA designs, tests have shown that the weapon can be hip or shoulder-fired by Battle Armor as well.

    [] HSA-50 'Gunzburg' Gauss-Powered LMG: Developed in parallel with the Skandia HMG, the new weapon system was to provide PAL troopers with an improved standard weapon that did not require stable firing mounts like the Skandia did. The result would be the Gunzburg Gauss LMG, named after the interstellar defensive line that would see some of the most exciting developments of the ORDI's theater of war during the Invasion. Capable of a greater rate of fire than the Skandia, the LMG was also designed to be hip or shoulder-fired by PAL troopers, as well as Battle Armor units. While it came at the cost of the LMG's stopping power, it also possessed greater effective range.

    Design
    [] Dropship Design: (tell me what you're trying to design)
    [] MAWLR Redesign: Order your design teams to redesign the MAWLR to make use of the latest technological advancements.
    [] Design write-in: Order your teams to design a solution to a capability gap. (tell me what you're trying to design)
     
    Last edited:
  • View discussion
    • The Clan Invasion -- January-March 3050 Results
  • View content
    • [X] Plan Homefront Focus
    https://forums.sufficientvelocity.com/threads/the-lords-of-ruin-battletech-killzone.52819/page-1080?post=31527042#post-31527042

    [X] Accept ComStar's offer at Tier 3 with the following caveat: as a part of their payment, they will assist us with our command circuit logistics.
    -[X] If the caveat is unacceptable to ComStar, agree to the Tier 2 offer instead.
    Historically willing to sell arms to neutral parties and with these instincts only reinforced in the face of the Clan invasion and its attendant threats, January 3050 saw the Helghan government consider ComStar's offer to purchase arms and equipment from Helghan carefully; the organisation's quasi-religious nature and position as caretakers of the Inner Sphere's HPG network weighed against the value of their offer. Eventually deciding that the Inner Sphere would require all the aid it could get should the Clans ever be in a position to attack Terra—the arguments leading up to that determination no less vicious for their privacy—the Republic's government determined that it would sell ComStar what they wanted, albeit with some conditions. Quickly reaching out to ComStar's Precentor Martial, Anastasius Focht, via HPG within weeks of the purchase request, Republic diplomats informed the organisation that Helghan would sell it all the weapons and equipment it could ask for so long as it agreed to grant ORDI JumpShips passage through Terra and its surrounds. Previously forbidden to the Republic due to ComStar's historic neutrality, Helghan politicians were willing to gamble that the growing proximity of Clan forces to Terra would leave the guardians of the HPG network willing to compromise on their principles.

    Fortunately for them, they were correct.

    Responding to the Helghan Republic's counter-offer within days of it being made, Precentor Martial Focht, acting as a representative of Primus Everson, agreed to the deal almost as presented, the sole change requested by ComStar being that ORDI troops would not be permitted to set foot on stations or planets in the region outside of the most dire emergencies. Recognising this as a sop to ComStar's reputation as peacemakers and unwilling to push their luck under the circumstances, the Republic's ruling government agreed to ComStar's counter-counter offer before the quasi-religious group could reconsider, both sides signing the secret deal by mid-January and the first exchange of C-Bills for weapons occurring shortly thereafter.

    Effect
    • ComStar agrees to permit ORDI JumpShips passage through ComStar controlled space, though assuages any guilt by refusing to permit ORDI troops to set foot on stations and planets in said systems outside of dire emergencies—a restriction that really doesn't matter
    • +3B C-Bills
    • Cargo vessels begin moving said equipment to terra


    [X] Speed the Wolves Along
    -[X] Taurian Concordat [-5 influence]
    Deciding that the more bodies on the frontline, the better—and doubly so when said bodies consisted of the Inner Sphere's most effective mercenary unit—early 3050 saw the Helghan government join the Capellan Confederation in voting to speed the Wolves' journey to the frontlines; both nations going so far as to suggest the use of the alliance's command circuit. Splitting the vote down the middle as a result, the Aurigan Coalition and Magistracy of Canopus having voted to merely permit the Wolves to make the journey, the Republic naturally turned to the functionally abstaining Taurians to provide the tie-breaking vote. Largely uninterested in how the Wolves arrived on the front, members of the Taurian government soon found themselves courted by their opposite numbers in the Republic, a score of Helghan diplomats prepared to put livers and stomachs on the line in order to regale key figures with reasons why the Concordat should vote with the Confederation and Republic.

    However, having primed themselves for a protracted campaign involving lakes of wine and tables of food, Helghan's diplomatic envoys soon found themselves at a loss when their counterparts proved easily swayed; the Concordat voting to permit the Dragoons access to the ORDI command circuit after the opening volley of luncheons. Despondent at their success, Helghan's diplomatic corps could only watch in despair as voting concluded and the ORDI agreed to transport the Dragoons to their destination, the sole salve for their wounded souls being the celebratory dinner held afterwards.

    Effect
    • -5 Influence
    • Concordat is swayed to vote with the Republic.
    • ORDI vote falls to speeding them on their way, the wolves accepting the offer.
    • Expected to arrive alongside ORDI ground troops in mid to late part of the quarter

    Trinity League
    [X] Commit Security Forces: Once the responsibility of those the Republic has since ousted/bribed to leave, the former Trinity League is bereft of security forces. Temporarily deploying Helghan security forces, while only a stopgap, will almost certainly help local police keep a handle on things. [Progress: 1/3]
    "You wanna know what annoys me about post-apocalyptic fiction? It's that the creator almost always tries to claim that the apocalypse reveals man's true inner savagery or some shit. 'If you take away food, water, electricity, and homes, people turn into monsters' type shit. I mean, shit. If I set a horse on fire and threw it into the ocean, it'd also be pretty fucking stressed out and act fucked as hell. So yeah, if you put humans in a perpetual crisis and destroy everything they've ever built, they won't do too hot, either." - Senior Lieutenant Detective Rada Borisov.

    "Alright, I just wanted to know what you thought about the movie. Jesus." - Lieutenant Detective Prokhor Van Bueren.

    Building off last year's efforts, 3050's first quarter saw Republic troops further lighten the load of local security forces by expanding their responsibilities within the former Trinity League to include numerous tasks previously considered of secondary importance and value. Ranging from off-shore policing to simple street patrols, Republic soldiers involved in the regional stabilisation force appeared in cities throughout the former Trinity League, their presence allowing local police forces to use their limited resources elsewhere. Simultaneously making Helghan troops a common sight on the streets of a half-dozen worlds while also limiting their negative interactions with the broader populace, this expansion of responsibility saw the opinion of both the government and public towards said troops rise noticeably; the sheer visibility of Helghan security forces paradoxically comforting for a region that had previously lived in fear of secret police.

    [Progress: 1/3] → [Progress: 2/3]
    Effect
    • Republic security forces continue their actions with aplomb, the offloading of so much work from local security forces allowing them to focus on maintaining peace while also preventing issues from arising between Republic troops and the local populace
    • Views towards the Republic actually improve among both civilians and planetary governments

    [X] Republic Planetary Militia: Devastated by the ousting of the ex-CCAF-turned-pirates-turned-warlords, the planetary militias of the former Trinity League are in no position to fend off even the weakest pirate raid. Rebuilding these militias with Republic stockpiles, while a distraction from the Rasalhague front, will give it substantial influence over them. [Progress: 0/2]
    "It has long been known that superior training and superior weaponry have a geometric effect on overall military strength. Well-trained, well-equipped troops can stand up to many more times their number than linear arithmetic would seem to indicate. It is my intention, therefore, to make you those well-trained and well-equipped troops.

    Now drop and give me twenty!" - Recruit Instructor Yaling Ryskamp

    Well aware that Trinity League militia forces had been all but gutted as a result of Operation Telemachus' success and increasingly concerned that their natural regrowth would limit Helghan influence over them, early 3050 saw the Helghan government order the various militias rebuilt; orders to that effect dispatched to the relevant parties within days of the New Year. Accepting these orders with mixed feelings, the ever-loyal Republic military immediately got to work actioning them, a sizable force of trainers dispatched to the nearby region to train the militias in the Helghan style and influence their internal politics. Sent to a destination only a few dozen lightyears away, these trainers—among them some of the Republic military's best training officers—arrived mere days after receiving their orders, the officers throwing themselves into the task with aplomb.

    For nigh-on three months, the fifty-plus trainers assigned to the task laboured to rebuild the militias, busloads of hopeful recruits whittled down by gruelling exercises and intense political scrutiny until only a handful remained from each cohort. The cream of the crop, at least as far as militias are concerned, the handful of recruits who made it past Helghan scrutiny were both physically in their prime and deemed politically reliable by political officers, each one fully trained on a variety of Helghan weapons temporarily assigned for just that purpose and formed into units patterned after those of the Republic military. Delivered to their respective homeworlds in a fraction of the time initially thought possible, these militia units were all but ready to defend home and hearth from external threats come mid-March, the sole thing holding them back being a lack of equipment to arm them with thanks to the ongoing Clan invasion and the burning need for military supplies throughout the inner sphere.

    However, fortunately for the former Trinity League and Helghan Republic alike, the Helghan civil service proved more than up to the task of resolving the issue.

    Working day and night in archives throughout Pyrrhus and other major cities on Helghan, members of the nation's civil service scoured the countless records of arms sales for any amount of weaponry which could be handed over to the League militias, every deal ever penned by the Republic examined with an expert's eye for loopholes and room to manoeuvre. The best of the best when it came to forensic administration, these public officers ran themselves ragged as they looked through physical and digital records for leads to follow, enough coffee to drown a regiment consumed in service of their quest. Then, almost anti-climatically, they succeeded—a half-forgotten clause in a half-forgotten arms deal with the Magistracy of Canopus activated and the intended shipment of Second Extrasolar War era equipment diverted to the Former Trinity League where it was received with gratitude by the newly reconstituted militias.

    [Progress: 0/2] → [Progress: 2/2]
    Effect
    • Process to rebuild the shattered militia goes very well, the damage not so great as everyone feared and republic trainers able to whip them into shape in just three months.
    • Reduced stock of weapons means that it's difficult to arm them all, but Republic admin staff rise to the challenge and find some stockpiles of second extrasolar war era weapons to give to planetary militia.
    • Action completes in one turn.

    URC
    [X] Set up a major media presence across the URC, allowing the Helghan Republic to both get a better idea on the course of public opinion across the URC and provide levers for which to influence it.
    "Gooood Morning Di-ieee Mooooot!!! " - DJ J.D.

    Building off earlier attempts to manipulate public sentiment in the United Rimward Collective, early 3050 saw the Helghan government launch a plan to develop their media presence in the region; a significant number of Marks disbursed to the relevant parties for just that purpose. Gratefully receiving the funds just a few weeks later, Republic personnel operating in the region elected to spend the money on expanding their existing efforts, a score of civilian vessels purchased secondhand and dispatched to shipyards across the Republic where the best shipwrights in the Inner Sphere quickly refurbished them and equipped them with high-power broadcast systems. With the work completed by early February, all ships checked and rechecked before launch, mid-February saw the civilian-craft-turned-pirate-radio-stations and their dedicated crews of disk jockeys, reporters, and assorted commentators arrive in Collective systems accompanied by starbursts of radiation, their antennas deploying and broadcast system warming before they even entered orbit over their respective target planets. Broadcasting radio programs to people across the Rimward Collective—many of which were crafted to put Helghan in a positive light—February's last half saw public opinion towards the Republic rise slightly as a result of the pirate radio stations... before plummeting sharply as the extent of the Republic's efforts became known to the region's inhabitants.

    Having recently become politically conscious in a way they hadn't been before and highly protective of their hard-won independence, the reaction of the Collective's populace was swift and almost universally negative regardless of location; the average inhabitant reportedly viewing the Republic's actions as an invasive and unwelcome intervention in local politics. Worse still, at least from one perspective, Neo-Jacobinist-aligned media across the region seemed to take the reaction of the populace as permission to launch an assault of their own, aggressive critique of Republic-backed media outlets coming thick and fast as February gave way to March. An unexpected failure on the part of the Republic's ordinarily media-savvy political manipulators, perhaps even a critical failure, the sole redeeming factor of the whole affair appears to be that the sheer amount of goodwill earned by the Republic has buffered both its overall reputation among the broader populace and the legitimacy of the government it has been trying to install; both merely bruised rather than broken.

    Effect
    • Unfortunately, growing polarisation combined with the obviousness of the move means that it's seen as a major intervention in local politics by a foreign power; locals reacting to things extremely negatively.
    • Neo-Jacobins are also extremely annoyed by the move, a lot of their internal media organs launching aggressive critique of Republic-backed media outlets
    • While it hasn't impacted views of the legitimacy of the Republic restored government, it has eaten away a substantial amount of goodwill the Republic earned previously.
    • Hopefully continued propaganda will see moods change in the future.

    [X] Infiltrate the Neo-Jacobins of the URC.
    "The lower level groups are incredibly disorganised. I tried to attend their meetings to build up some rep with the serious operators, but half the time, no one showed up, and the other half of the time, the meetings were so confusing it was impossible to follow what they were saying. I feel like I need to read fifty books I've never heard of and pray." - Field report extract, Agent MERCURY, 23/02/3050

    Viewing the United Rimward Collective's Neo-Jacobinist parties with growing suspicion as the months progressed, January 3050 saw the Helghan Republic take the until-then unprecedented step of ordering state intelligence services to begin infiltrating the increasingly oppositional organisations; Helghan operatives departing for Jacobinist planets within a matter of weeks such was the importance placed on said activities. Slipping through what few border controls existed with ease thanks to their training and the lack of nationwide security, Republic agents arrived without raising a ripple of alarm, their falsified documents labelling them everything from skilled workers to immigrants from the Federated Suns seeking greener pastures in the newly independent nation. No doubt quite pleased with themselves, these agents immediately started trying to penetrate the various Neo-Jacobinist organisations on their respective planets, only to find the task harder than expected.

    Though able to penetrate the lowest rungs of these organisations—Helghan operatives inserting themselves into low-level volunteer positions such as pamphleteers, food distributors, etc.—they found themselves universally locked out of more sensitive positions due to a lack of time in service and ideological zeal; Jacobinists sensibly requiring substantial proven commitment before exposing themselves to harm. No doubt a response to the actions of planetary governments and the Federated Suns' federal intelligence services, said behaviour has had the unfortunate side effect of locking Republic spies out of sensitive positions and rendering them unable to report on all but the most mundane facts. While greatly upset by this turn of events, Republic intelligence services have consoled themselves and their superiors with the knowledge that said spies seem to have flown under the Jacobinist radar and that the door remains open for future infiltration attempts.

    Effect
    • While able to get some agents in on the ground level of jacobinist groups, penetrating into any level above that requires both time in service and ideological zeal.
    • Try again later.

    [X] Task our intelligence agencies with investigating the Jacobins and determining if there's something shady causing all this.
    "Where imperialists do not find disorder, they create it deliberately. They want an excuse for going in." - Josias Simões, Lead Analyst

    Launched alongside efforts to infiltrate Neo-Jacobinist groups in the United Rimward Collective, 3050's initial months saw a legion of Helghan intelligence analysts assembled and ordered to investigate whether the political movement was receiving sponsorship from external parties such as the Federated Suns. Intending to take advantage of the concurrent infiltration by Helghan field agents, the unanticipated failure of these agents to penetrate sensitive areas of Neo-Jacobinist politics meant that the expected flood of first-hand information failed to materialise, the assembled host of Republic analysts blindsided by the failure and forced to gather information from second, third, and even fourth-hand sources. Extremely skilled thanks to years of faithful service and able to tease out hints of meaning from even the most obscured source, Helghan's intelligence services did not let this unexpected roadblock get in their way for long; the thin gruel of data gathered by the Republic processed and scrutinised until a narrative began to emerge.

    Though somewhat fuzzy compared to intelligence coups such as the discovery of Duke Michael Hasek-Davion's suicide and with only a handful of analysts willing to stake their careers on their conclusions, the information gathered in lieu of first-hand accounts suggests that the worst fears of the Gemini government are indeed accurate. According to the story that has emerged from the data, Neo-Jacobinists at the highest levels are coordinating their activities with the Federated Suns; snatches of conversation intercepted by SIGINT sources deconstructed into keywords and codenames that speak of some manner of secret plan. What that plan may be remains as yet undetermined, but already the knowledge is causing a stir in the Republic's government.

    Effect
    • Lacking any real penetration into the Jacobinist inner circles, Helghan analysts are forced to try and work things out from the outside; compiling dossiers and conducting analyses from whatever scraps of info they could glean.
    • Resulting information is somewhat fuzzy, but Republic intel agencies have developed a case suggesting that the Federated Suns is backing the Jacobinists and manipulating them

    Other
    [X] Establish a continuing effort to provide propaganda relating to the Clan war effort (lock 1 AP to propaganda)
    "Look, I'm not saying they didn't hit gold with that "Daisy" ad, but I am saying that it's played out. Having that girl picking flowers and ending on the implication of an orbital strike reminded people of New Bergen... the first time they ran the campaign. The second time around, it just reminded people of the ad." - @UNACTO13. (3050, March 10). Clan assault on Free Rasalhague Republic [Online forum post]. forums.amplespeed.com.

    Eager to bolster flagging support for military action against the invading Clans, January 3050 saw the Republic's ruling party quietly authorise a massive propaganda campaign aimed at all quarters of the Helghan public; the same crack team of marketers responsible for last year's successes reinforced with a new crop of personnel and a markedly larger budget. Swiftly developing their preferred plan of attack—print, video, holo, WarpComm, and dozens of other platforms targeted for a widespread media blitz—these experts launched their assault on the hearts and minds of Republic citizens barely a month into the year, the resulting campaign all but inescapable such was its reach. Expected to stir the hearts of even the dourest Helghan citizens to action, the campaign building on all that had come before it and utilising previously successful methods of outreach, reality proved itself far less cooperative than initially hoped, the needle of public opinion barely shifting over the quarter despite the vast sums of Marks and person-hours spent on the project.

    Effect
    • Effort fails, but not badly enough to exacerbate war exhaustion. Instead the messages just don't land like they used to.

    [X] Expand our spy satellite network in Clan occupied space
    In contrast to the Republic's programs to shift public opinion and insert agents into the United Rimward Collective's Neo-Jacobinist movement, efforts by the task force involved in Operation Santiago to deploy additional spy satellites in the region met with great success. With the process of constructing spy satellites in situ using materials purchased from or donated by the Rasalhague Republic hammered out and with next-generation sensor packages installed in the latest models, the January-March period saw Republic starships deploy dozens of satellites across numerous systems. Equipped with new long-range sensors launched into obscure orbits by personnel now well-versed in their deployment, these satellites plummeted through the empty void of space with nary a hint of their passage; the interceptions that had plagued the last attempt now non-existent thanks to the combination of stealth and obscurity.

    Hidden from the sight of their would-be hunters and able to see further and at a higher resolution than ever before, these satellites immediately got to work reporting on Clan movements over the quarter, their built-in black boxes allowing them to broadcast a steady trickle of images and reports from systems lightyears deep into Clan territory. Broadly consisting of the kind of inter-system redeployments present in any military campaign, several of these reports nonetheless detailed a notable number of Clan JumpShips from every invading Clan heading Corewards, their destinations unknown, but Helghan analysts confident that they are bound for the Clan Homeworlds. Their curiosity piqued by the Clans' strange movements, said analysts naturally turned to the ORDI's collection of POWs in search of answers, the curiously loyal prisoners informing them that, in the process of defending Skandia from the Smoke Jaguars, the ORDI had likely killed ilKhan Leo Showers.

    Already intrigued by the idea that the ORDI had wounded the Invading Clans as a whole at Skandia, Republic analysts and their ORDI counterparts became positively ecstatic when the prisoners further explained that selecting a new ilKhan would be a process best measured in months and would require the presence of all Khans; the decision requiring much debate and argument by the leaders of the various Clans. A distraction from the invasion of the Inner Sphere regardless of how it's sliced and one purchased at high cost, the knowledge that the ORDI had accidentally bought the Inner Sphere a temporary respite saw a wave of relief wash through the Republic government. While the timeframe given by ORDI POWs was vague, all agreed that it would likely be several months before the Clans would be in a position to resume their invasion, a fact that ORDI military planners greeted warmly.
    Effect
    • Effort to expand spy satellite network deeper into clan occupied space goes extremely well.
    • Improved sensors means that they can be launched from further away, and republic ships learn good deployment strategies that hide their orbits from clan hunters.

    [X] Operation Santiago Phase 5 Objectives
    -[X] Send two squadrons (6) Nocti (ideally B-refits) to replace the damaged Noctis and fill the naval cap. Add additional Nocti if ConStar's efforts increase our naval cap any further. Add more Commissars as it becomes possible to do so, rotating non-shielded ones out for shielded refits. Replace Clarion Call with a fresh MAWLR-II from Helghan and return her to Helghan for repairs. Deploy the two MAWLR-IIs forward deployed on Tsitsang. Fill our remaining cap, including whatever capacity ComStar provides as part of our deal, with divisions, starting by deploying the rest of Fourth Division.
    -[X] Utilizing both ground and naval reinforcements, as well as what units in theater already that can be spared from holding the line, and as many elements of the Dragoons as we can get, engage Clan Wolf with the intent of forcing the Wolves back from their salient closing in on Fort Loudon. Our goal is to secure the FRR-LC border worlds currently held by Clan Wolf from Rasalgethi to Laurent, running as far west as Benfled.
    -[X] Remaining units within the FRR are to continue to hold the Gunzberg line. Naval units are to raid enemy shipping and assist in holding the line.
    -[X] Offer additional WS to the DC if they are willing to support them. Request if possible that our WS be deployed to attack Snow Raven holdings.
    Keenly aware of the wolves prowling outside Fort Loudon's borders and that the time bought by the recent defeat of the Smoke Jaguars and the death of the ilKhan was already ticking down to nothing, Q1 3050 saw Operation Santiago's high command throw themselves into preparing a counter-attack against the wolves; ORDI units deemed extraneous to the Gunzberg Line's needs pulled from the border and formed into a multi-national task force. Veterans of numerous battles with bonds forged in the fires of war, these units were quickly reequipped from the river of war material entering the Rasalhague Republic and moved, in great secrecy, to staging points along the Rasalhague-Wolf border. Joined in early February by fresh reinforcements from the rim and the Wolf Dragons—the arrival of whom was greatly hastened by the newly expanded command circuit established through Terra—these assault forces waited with bated breath for the order to launch. Only a few weeks later, with the governments of five nations breathing down his neck, Commodore Ostergaard gave it.

    Like a bolt of lightning cast from Zeus' hand, the ORDI task force struck out from their staging points along the fractious border, warpships bearing thousands of troops shooting forth across the void of space toward targets scattered across dozens of lightyears. Stuck fast due to what ORDI analysts were already realising were cultural reasons, the invading wolves were struck by the full force of the ORDI counter-attack only a few days after they departed, the leading edge of the Wolf assault force on Rasalgethi the first to taste the ORDI's fury. Facing off against overwhelming ground forces backed up by tactical orbital support from the ORDI's warships, the officer in command of the Wolf unit charged with defending the world, one Athen of the 328th Assault Cluster, surrendered after two weeks of intense planet-wide conflict that saw heavy casualties on both sides thanks to the cunning use of urban environments.

    Emboldened by their success and undeterred by the fierceness of the fighting it took to achieve, ORDI forces proceeded to strike out against the nearby systems of Tomans and Crimond. Accompanied by some of the Dragoons' best units and well-versed in fighting the Clans, those ORDI veterans pitted against Toman struck the planet's defenders without mercy; Clan Wolf's hold shattering like glass under a sledgehammer as invading forces overran all defences and crushed their opposition within days. To the great displeasure of Operation Santiago's command staff, such a wild success was not to be in the nearby system of Crimond.

    Commanded by a Star Colonel Nadine, the 4th Wolf Guards Striker led ORDI assault troops on a wild goose chase across much of the planet's terrain, consistently evading the eyes of their attackers thanks to their small size and high speed. For two and a half weeks, a lifetime in combat terms, the sly wolves frustrated the would-be conquerors by striking wherever the ORDI was weakest, patrols, convoys, and half a hundred other things hit by Wolf troops who vanished into foreboding forests and unchartered mountain ranges before a response could muster. Costing ORDI forces a great many lives with their hit-and-run tactics, the slipperiness of the Wolf defenders finally ended after MechWarriors belonging to Warrior House Daidachi succeeded in engaging them in force; the subsequent string of aerospace strikes and the threat of orbital bombardment seeing Star Colonel Taylor's second-in-command surrender.

    Comparatively speaking, the subsequent attack on the nearby system of Orkney proved almost an anti-climax, late March seeing the infamous Black Widow Battalion under the command of the equally infamous Natasha Kerensky land ahead of ORDI forces in contravention of their orders. Already infuriating the invasion force's commander by racing ahead, Kerensky only made matters worse by invoking Zellbrigen and challenging the 352nd Assault Cluster defending the planet for possession of the system. No doubt expecting an easy victory against an inferior opponent—or else eager to take advantage of their enemy splitting up their forces—the defending wolves accepted the challenge, only to learn why Natasha Kerensky is infamous in the Inner Sphere. Utterly annihilating her opposition, March's close saw Natasha Kerensky claim the planet for the Inner Sphere and a Timber Wolf Heavy mech for herself, the assault force's commander reportedly letting her have it if only to get her out of their hair.

    Concurrently with this ambitious counter-attack against the Wolves, ORDI warships launched their own strikes against Clan forces; Clan supply convoys throughout the Invasion Corridor targeted for destruction by ORDI wolfpacks. Guided by data gathered by spy satellites and taking full advantage of their strategic mobility, ORDI warships struck out against the Clans' vital supply lines with wild abandon, convoys of JumpShips and their defenders torn apart in ambushes whose violence stained the night-black void.

    Capping off these riotous successes, the end of March also brought with it the culmination of Republic diplomatic efforts with the Draconis Combine. A famously isolationist state though the Combine may be, the nation's new leader proved far more interested in foreign arms than his late lamented father. Listening to the Republic's offer graciously, Coordinator Theodore Kurita accepted the two proffered Nocti after some consideration and a commitment from Helghan that careful separation would be maintained, the mighty warships moving to join their siblings in the Combine within days of agreement.

    Effect
    • Need to defend the Gunzburg Line means that the counterattack is delayed until February so reinforcements have time to arrive, but ORDI troops combined with Wolf Dragoon forces smash into the wolves threatening Fort Loudon.
    • Strike against the leading edge of the wolf assault force on Rasalgethi leads to high casualties, but Clan Wolf's assault forces are devastated in exchange, the officer in charge surrendering after two weeks of intense planet-wide battle. Interestingly, prisoners taken in the attack confirm that their leaders and best warriors are heading back to elect a new ilkhan.
    • Subsequent attack on Tomans is much more effective, with allied troops overrunning Wolf second liners. Crimond proves a harder nut to crack with the commander leading the attackers on a lengthy goosechase that cost many lives before being whittled down and forced to surrender. Orkney collapses within days on conflict starting thanks to the dragoons being ultra aggressive.
    • Meanwhile, anti shipping raids go extremely well, several major convoys hit and their cargos and escorts destroyed.
    • Combine accepts the offer of additional warships, the state able to support 2 more nocti.

    Design and Requisition
    [X] Primitive Pulse Laser Systems:
    [X]     Jekyll&Hyde
    [X] HSA-50 'Gunzburg' Gauss-Powered LMG
    [X] HTBA-01 Battle Armor

    News and Rumour
    Helghan Republic
    Continuing earlier trends, March 3050 saw refugee arrival rates in the Rimward Periphery increase slightly over the year's first three months; well over 2 million additional men, women, and children arriving in ORDI systems compared to the same time three months ago. Met by well-funded teams of ORDIHCR personnel, many such refugees found themselves slotted into the multinational alliance's refugee system without issue. No doubt relieved to have arrived after a prolonged journey filled with unimaginable hardships, many expect these refugees to permanently settle in the rim.

    Predicted Refugee Acceptance Breakdown For 3050 (+-5%)
    Helghan Republic:     25,900,000
    Aurigan Coalition: 1,850,000
    Capellan Confederation: 11,600,000
    Magistracy of Canopus: 5,000,000
    Taurian Concordat: 3,200,000

    Somewhat to the surprise of the Helghan Government, mid-February saw the Magistracy of Canopus reach out to its long-term ally to request permission to dispatch a team of civilian geneticists to the Cassildan POW camp where Clan prisoners are being held. According to the Canopians, these geneticists have repeatedly petitioned the government for access as they are interested in determining the long-term effects and viability of genetic manipulation within humans, and the Clans represent the perfect case study. While some within the Republic have baulked at giving Canopian civilians such access for security reasons, others have found the geneticists' premise interesting enough to consider granting the move. As with similar requests in prior years, the arguments about what to do will likely only conclude sometime next quarter.


    Put aside some time ago, January 3050 saw the return of debate concerning the size of the recruitment pool for Helghan's cybernetically enhanced soldiers. Currently only recruited from among the Republic's general military, Helghan cybernetic troopers represent a proven force responsible for numerous military victories throughout the Inner Sphere, the primary limiting factor of their use being the cadre's small size at only two regiments. With several years' worth of reports and studies now backing them up, proponents of expanding the recruitment pool to encompass the general population have struck back against those who succeeded in arguing for a more limited rollout by claiming that said expansion would offer the Republic a significantly larger pool of candidates to draw from with little to no risk of blowback. Opposing them, proponents of the status quo have argued that expanding recruitment will open up more points of failure for negligible gain and make it harder for the Republic to maintain the degree of scrutiny it has been able to impose on volunteers so far.

    Remaining unsettled by the time the quarter drew to a close, the debate will likely rage on for the foreseeable future.


    Aurigan Coalition
    Continuing to demonstrate an unwavering commitment to mutual defence—or simply realising that the nation would have an easier time supporting a robust navy versus an equivalent army—March 3050 saw the Aurigan Navy welcome nine more Halcon class Destroyers into its ranks; the 500,000-ton vessels launched with little of the fanfare that accompanied the first examples of the class. Immediately deployed to help patrol the rim for signs of pirate activity, these new vessels have already shown their worth by assisting refugee vessels that have suffered breakdowns on their way to ORDI space; images of Aurigan Marines and naval personnel helping children, the sick, and the infirm broadcast across the WarpComm network. Likewise, Aurigan shipbuilding has welcomed three additional 500,000-kt slipways, bringing the Aurigan Coalition's total number of slipways up to twelve, with three more planned for the end of June.


    Capellan Confederation
    To the great delight of Helghan Tread Heads—aka Helghan tank enthusiasts, aka battlemech critics, aka tank nerds—late January saw the Capellan Confederation unveil its first ultraheavy design to the galaxy. Dubbed the Shaanxi Sea Monster after the location in which it was designed, built, and tested, the Confederation's 40,000-ton ultraheavy hovercraft is one-part troop transport and one-part siege platform; the hovercraft able to transport gargantuan force to a location and lay waste to anything in its path. Equipped with powerful energy shields courtesy of the Republic, heavy armour, and a network of point defence weapons, the Shaanxi Sea Monster can also survive extreme amounts of firepower; the combination of survivability and lethality allows it to deploy troops to the battlefield and provide fire support all the while. While information on the inner workings of the CCAF is currently scarce, the Republic not being in the habit of spying on its allies in any serious way, the CCAF's highest echelons are reportedly quite pleased with the design's performance in simulated battles and may be looking to expand the Confederation's roster of ultraheavies shortly.

    Code: 
    Shaanxi Sea Monster
Type: Ultraheavy Hovercraft
Mass: 40,000 tons
Technology Base: Inner Sphere (Advanced) 
Introduced: 3050
Mass: 40,000
Battle Value: 8,497
Tech Rating/Availability: E/X-X-E-D
Cost: 1,401,677,928 C-bills

Transit Mechanism: Ultraheavy Anti-Gravity
Dimensions: 
    Length: 230 meters
    Width: 70
    Height: 40    

Power Plant: Visigrad 300,000 Fusion Plant
Cruise Speed: 3
Flank Speed: 5
Heat Sinks: 450 (900)
Structural Integrity: 10

Armor
    Nose: 118
    Sides: 100/100
    Aft: 82

Equipment
    1 Active Probe (Beagle)
    1 MASH Equipment (1 Theater)
    1 Communications Equipment
    1 Field Kitchen
    1 Improved Energy Shield (250 tons | 25 heat/turn | 800 points)

Cargo
    Bay 1:  Mech (108)              4 Doors   
    Bay 2:  Infantry (Motorized) (210)2 Doors   
    Bay 3:  Heavy Vehicle (108)     2 Doors   
    Bay 4:  Cargo (1000.0 tons)     1 Door    

Ammunition:
    200 rounds of Arrow IV ammunition (4 tons), 
    3,216 rounds of LRM 20 ammunition (536 tons)

Escape Pods: 0
Life Boats: 0
Crew:  12 officers, 9 enlisted/non-rated, 21 gunners, 1920 bay personnel        

Notes: Mounts 36 tons of standard aerospace armor.

Weapons:                      Capital Attack Values (Standard)
Arc (Heat)                Heat  SRV     MRV     LRV     ERV   Class       
Nose (86 Heat)
8 Laser AMS               56   2(24)    0(0)    0(0)    0(0)  AMS         
10 H-Medium Laser         30   5(50)    0(0)    0(0)    0(0)  Laser       
RS/LS Fwd (160 Heat)
8 Laser AMS               56   2(24)    0(0)    0(0)    0(0)  AMS         
2 Arrow IV                20    0(0)    0(0)    0(0)    0(0)  Artillery   
    Arrow IV Ammo (50 shots)
20 H-Medium Laser         60   10(100)  0(0)    0(0)    0(0)  Laser       
4 LRM 20                  24   5(48)   5(48)   5(48)    0(0)  LRM         
    LRM 20 Ammo (804 shots)
RS/LS Aft (160 Heat)
8 Laser AMS               56   2(24)    0(0)    0(0)    0(0)  AMS         
2 Arrow IV                20    0(0)    0(0)    0(0)    0(0)  Artillery   
    Arrow IV Ammo (50 shots)
20 H-Medium Laser         60   10(100)  0(0)    0(0)    0(0)  Laser        
4 LRM 20                  24   5(48)   5(48)   5(48)    0(0)  LRM         
    LRM 20 Ammo (804 shots)
Aft (86 Heat)
8 Laser AMS               56   2(24)    0(0)    0(0)    0(0)  AMS         
10 H-Medium Laser         30   5(50)    0(0)    0(0)    0(0)  Laser

    Of great interest to naval thinkers the ORDI over, March's close brought with it the arrival of two new warships to the Capellan Confederation navy, the million-ton designs emerging from the nation's orbital shipyards with much fanfare. Named the Fenghuang after the mythical bird of Sinospheric mythology, the Confederation's latest warship is designed to provide long-range sniper support against hostile warships; the ship's Heavy Naval PPCs able to engage targets at extreme range thanks to the vessel's advanced fire control systems and their inherent accuracy. Though protected by an incredible eight Improved Energy Shield generators and equipped with numerous H-Medium Lasers for close-in defence, the Fenghuang is not intended to fight targets at close range, instead dealing consistent damage from far outside the effective engagement range of almost all vessels and either dodging, shooting down, or tanking any return fire.

    With two ships already completed and two more on the way, the ORDI can expect a glut of heavy warships soon.

    Code: 
    Class/Model/Name:    Feng Huang Lords of Ruin
Mass:    1000000 tons

Equipment                                                 Mass
Engine:    Fusion Engine                                  240000
Safe Thrust:    4    
Maximum Thrust:    6    
Structural Integrity:    110                              110000
Total Heat Sinks:    5409 Double [10818]                  4672
Bridge, Controls, Radar, Computer & Attitude Thrusters    2500
Fire Control Computers                                    12184
Food & Water (180 days supply)                            2319.5
Spare Parts (1 percent)                                   10000
Fuel & Fuel Pumps (25000 Points)                          10200
Kearny-Fuchida Hyperdrive Compact (21 Integrity)          452500
Large Naval Comm-Scanner Suite                            500
Armor:    Standard (874 total armor pts)                  2200

                      Capital Scale Armor    
Front                 174    
Fore-Left/Right       140/140    
Aft-Left/Right        140/140    
Aft                   140    


Bays and Cargo:        
  Bay 1:    26 Small Craft Bay with 6 doors               5200
  Bay 2:    42 Fighter Bay with 2 doors                   6300
  Bay 3:    Cargo Bay (Standard) with 2 doors             1719.5
Dropship Capacity:    6                                   6000
Life Boats:    93                                         0
Crew:        
57      Officers (40 minimum)                             570
188      Crew (199 minimum)                               1316
84      Gunners                                           588
96      Marine Battle Armor Troopers/Elementals           672
214      Bay Personnel                                    0
12      Specialists (6 minimum)                           84


    Weapons & Equipment    Loc     SRV      MRV      LRV      ERV      Heat      Mass
2    NL35                  Nose    7(70)    7(70)    7(70)    0(0)     104       1400
12   Laser AMS             Nose    0(0)     0(0)     0(0)     0(0)     84        18
10   H-Medium Laser        Nose    5(50)    5(50)    5(50)    0(0)     30        10
2    Heavy NPPC            Nose    30(300)  30(300)  30(300)  30(300)  450       6000
12   Laser AMS             FL/R    0(0)     0(0)     0(0)     0(0)     168       36
10   H-Medium Laser        FL/R    5(50)    5(50)    5(50)    0(0)     60        20
4    Heavy NPPC            FL/R    60(600)  60(600)  60(600)  60(600)  1800      24000
4    NL35                  FL/R    14(140)  14(140)  14(140)  0(0)     416       5600
12   Laser AMS             L/RBS   0(0)     0(0)     0(0)     0(0)     168       36
10   H-Medium Laser        L/RBS   5(50)    5(50)    5(50)    0(0)     60        20
4    Heavy NPPC            L/RBS   60(600)  60(600)  60(600)  60(600)  1800      24000
4    NL35                  L/RBS   14(140)  14(140)  14(140)  0(0)     416       5600
4    Heavy NPPC            L/RBS   60(600)  60(600)  60(600)  60(600)  1800      24000
12   Laser AMS             AL/R    0(0)     0(0)     0(0)     0(0)     168       36
10   H-Medium Laser        AL/R    5(50)    5(50)    5(50)    0(0)     60        20
4    Heavy NPPC            AL/R    60(600)  60(600)  60(600)  60(600)  1800      24000
4    NL35                  AL/R    14(140)  14(140)  14(140)  0(0)     416       5600
2    NL35                  Aft     7(70)    7(70)    7(70)    0(0)     104       1400
12   Laser AMS             Aft     0(0)     0(0)     0(0)     0(0)     84        18
10   H-Medium Laser        Aft     5(50)    5(50)    5(50)    0(0)     30        10
8    Imp.Energy Shields    Body    0(0)     0(0)     0(0)     0(0)     800       8000
                                
    TOTALS:                        351      351      351      270      10818    129824


    Continuing the theme of naval development, Q1 3050 also saw the Capellan Confederation labourers complete work on six additional 500-kt slipways, bringing the total number of said slipways in the nation up to sixteen. With ten more Carson II class frigates already on the way and set to arrive in Q2 3050, the Confederation has reportedly shifted its attention away from expanding its 500kt shipbuilding capacity to expanding the capacity of its existing shipyards and constructing additional 1,000,000-ton-rated orbital shipyards. Expected to be completed by EOY 3050 and EOY 3052, respectively, this increase in shipbuilding capability will put the Capellan Confederation comfortably ahead of the Helghan Republic when it comes to megatonne warships.


    Taurian Concordat
    To the disappointment of figures within the Helghan government, Q1 3050 has seen the Taurian Concordat continue to struggle to deliver the rights and services it promised to the people for the former Outback, frustration at the lack of progress prompting frustration on both sides of the equation. Despite the Concordat's roaring economy—a side effect of growing regional trade—the sheer number of planets and citizens added to the Concordat after the Outback Intervention has absorbed vast quantities of sweat and treasure in exchange for few visible results. While reports from the region suggest that progress is happening, those reports also indicate that said progress is slow in the extreme; many communities left materially no better off under the Taurians than they were under the Federated Suns. A concerning situation, especially with the United Rimward Collective experiencing its own dysfunction nearby, many within the Republic hope that the recent addition of three Horus class mobile factories to the region will help alleviate the worst of the issue and speed up the resolution of material concerns.


    No doubt angering those who would prefer the money be spent delivering fundamental services to the people of the Taurian Confederation, March 3050 saw five new Vanguard class corvettes join the Taurian Navy; the quintet of vessels raising the total number of warships in the Taurian fleet to fifty-two and the total tonnage to thirteen megatons. A sizeable force even by the standards of the unlamented Star League, the Concordat nonetheless appears unsatisfied with its capabilities, the nation immediately starting work to transform three of its 200,000-ton rated slipways into the larger and more capable 500,000-ton rated versions.

    Magistracy of Canopus
    Likewise, March 3050 saw three additional Canopus class frigates join the rapidly developing Canopian navy, the trio of vessels deployed to patrol the northern border of the former Trinity League and prevent opportunistic raids by pirates and other foes. Following close on the heels of this development, the Magistracy of Canopus also announced the completion of three additional 500,000-ton slipways, the nation's shipbuilding capacity increasing by 33% and additional slipways already under construction.


    Trinity League
    To the great relief of Republic lawmakers and citizens alike, recent actions undertaken within the Trinity League appear to have stabilised the former bandit-kingdom to some degree, the entire three-month period between January and March passing by with only the usual number of incidents. Though currently little more than a rough collection of planets whose local administrations are propped up by Republic security forces and military personnel, the situation is not quite as critical as it once was. Still a long way away from being a remotely stable state, it seems Helghan's efforts have done much to resolve the initial shock of a post-Telemachus world


    United Rimward Collective
    Surprising only the most incurious souls, calls for the URC's capital of Firgrove to join the Federation of Autonomous Systems have only grown in strength and volume over the new year, the fringe position becoming more and more popular as the Jacobonists ramped up their own anti-Marxist propaganda. One of the more industrialised systems in the would-be nation due to a history of local development untrammelled by the otherwise extractive policies of the planet's rulers, the loss of Firgrove to the FAS would be painful but survivable, the embarrassment of such a thing occurring likely more of a hindrance to the nation's future development than the loss itself. However, undoubtedly understanding who the Jacobinists will turn their attention to next should they succeed in ejecting the Marxists from the Collective, the Maoist-Gaullist groups in the nation's spinward reaches have begun their own AgitProp campaigns against the Jacobinists, the cool but peaceful relationship between the two movements growing increasingly frigid and tense as the months wore on.


    Federation of Autonomous Systems
    In contrast to the United Rimward Collective, the situation in the Federation of Autonomous Systems remains cordial at worst; the loosely connected nature of the nation, combined with the lack of interference in local affairs, appears to allow the disparate groups within the FAS to coexist peacefully. As if that wasn't good enough news for the Gemini government, mid-February also saw the Federation's requests regarding the recovery of stolen wealth granted by ComStar, adepts of the order reportedly fully cooperating with Federation police and assisting them in the recovery of several million Marks worth of C-Bills with more reportedly on the way. While ComStar's neutrality and obstinance to interference—especially when it comes to HPG services and banking—is famous across the Inner Sphere, it seems that the Republic's recent decision to sell the quasi-religious organisation a great deal of military equipment has led to a sudden and much-welcome burst of cooperation.


    ComStar
    Speaking of ComStar, reports from across the galaxy have arrived on Helghan that describe a widespread recall order now in effect for ComStar security forces throughout the Inner Sphere. Posted at Hyper Pulse Generator sites across literally thousands of planets since the 4th Succession War, these security forces primarily consist of infantry and light vehicle units, with the occasional hired merc company or two thrown into the mix wherever pirate raids are a concern. Self-admittedly posted to HPGs to maintain site security and—in the minds of the Republic's more cynical analysts, at least—to act as a tripwire force should any ruler get any funny ideas about who owns the HPGs, these units are meaningless individually, but incredibly potent collectively; a hastily ordered analysis positing that ComStar can indirectly call on many thousands of troops. Given ComStar's recent interest in securing weapons and ammunition from the Republic and its secret admissions, many within the Helghan government believe this to be merely the first outwardly visible sign of ComStar preparing to fight the Clans.


    Clan Invasion (Varied)
    According to reports from the coreward front, early March saw the first use of ground-based Petrusite weaponry by Clan forces, elements of Clans Wolf and Snow Raven making use of Petrusite weaponry in defence of their newly captured planets. While intel on the Snow Raven side of the equation remains scarce as a result of the Republic's poor penetration into the Combine, intelligence gathered during the strikes against Clan Wolf has revealed that the Wolves have begun deploying primitive Petrusite cannons among some of its best units. Painful to fight against without energy shields thanks to the substance's penetrative effects, the low quantity of Petrusite weapons so deployed combined with their inferior nature when compared to Republic versions has nonetheless resulted in them having little impact on the battlefield; airstrikes proving the perfect counter.

    A not-unexpected turn of events, the appearance of primitive Petrusite weaponry on the battlefield has nonetheless sparked anxiety among the Republic's civilian and military leaderships; both groups concerned that the Clans may deploy Petrusite weapons in increasing numbers and sophistication in the coming months. Worse still, some within the Helghan government have pointed out that the development of effective Irradiated Petrusite weaponry took Stahl Arms less than six months from the discovery of the substance and that its synthesis is as easy as bombarding a sample of Petrusite with ionising radiation. Significantly more lethal than the already deadly Petrusite, the development of Irradiated Petrusite weaponry by the Clans could prove war-winning in the worst case.


    While information currently remains scarce, unsubstantiated reports from those few Helghan spies operating with the Lyran Commonwealth combined with vague statements from Lyran officials suggest that the Kell Hounds—a mercenary unit long associated with the Commonwealth and run by brothers Morgan and Patrick Kell—has suffered heavy casualties during the LCAF's counter-attack against Clans Diamond Shark and Coyote. Positioned at the tip of the spear due to their elite status, the Kell Hounds reportedly landed on Arc-Royal as part of the first wave of troops, Clan Coyote's own elites engaging them almost the moment they stepped foot out of their dropships. While there's little information to go on, what information is available suggests that one or both of the brothers were injured during the fighting to an unknown degree and that the Kell Hounds have suffered many losses. Given the importance of mercenary units to Inner Sphere military campaigns and the overall effectiveness of the Kell Hounds prior to this event, the injury or death of one or both of the Kell brothers could have deleterious effects on the progress of the LCAF's counter-attack.

    Likewise, the Eridani Light Horse have reportedly found Clan Diamond Shark to be much more of a challenge than initially expected, the fresh forces and equipment of the anti-Spinward Clan allowing Diamond Shark warriors to bog down the Light Horse in bitter fighting. Claiming descent from the SLDF, the Light Horse have responded to the Clan invasion by fighting as hard as they've ever fought before, reports from ORDI spies describing vicious barbs and other insults traded between the two groups even in the midst of battle. A not-uncommon event in the Clan Invasion, one such exchange caught the attention of Republic analysts after a Star of Clan mechs diverted from their path to attack and kill one Lieutenant Andrew Hallis of the Eridani's 151st Light Horse Regiment in response.

    Intrigued as to why a star of mechs would go out of their way to assassinate an otherwise unremarkable lieutenant, Republic interrogators turned to the ORDI's POWs for answers; a recording of the man's rather anodyne boasts and insults played for them to provide enlightenment. Initially bored by the process, the attitude of said POWs quickly changed after they learned the name of the man killed by Diamond Shark forces, the four of them suggesting that he was made a target by his relation to the SLDF's Lieutenant General Frederick Hallis. Unusually reticent to discuss Clan history, the most the four prisoners would say was Frederick Hallis' son had done something that rendered his bloodline forfeit in the eyes of the Clans—the same kind of insane order Aleksandr Kerensky had made regarding Stefan Amaris' family replicated and placed on the wider Hallis bloodline at some point in the Clans' history.


    In a turn of events that is no less strange than the assassination of Andrew Hallis, BattleROM footage recovered by Rasalahagian guerrillas on Radlje and shared with the ORDI has shown an entire star of Snow Raven mechs falling in battle to a single Marauder. Pulled from the backup recording system of a Puma following its pilot's death by PPC blast, the extent of the recovered footage is a six-minute clip in which a black-painted Marauder can be seen ambushing and annihilating the Clan mechs from the snow; not a single shot from the Clanners landing despite the black Marauder's assumed technological disadvantage. No doubt piloted by a veteran of many battles, a given considering the skill at arms displayed in the footage, the subsequent request for clarity made to the KungsArmé proved disappointingly unhelpful; no record of any such Marauder being present on Radlje prior to the system's fall to Clan Snow Raven.

    Faced with far bigger fish to fry, the Helghan General Staff have responded by either outright declaring the footage as doctored or dismissing it as unimportant.



    Federated Suns
    Rather concerningly to those whose eyes aren't locked on the coreward struggle against the Clans, reports from ORDI spies and local news services suggest that right-wing nationalism is only continuing to grow in popularity throughout the Federated Suns; economic hardship triggered by the loss of the Outback driving increased extremism among all sectors of FedSun society and the growth of various right-wing movements. Though recent initiatives by First Prince Morgan Davion have done much to prevent the economic situation from spiralling out of control and, in doing so, limiting the growth of these groups, the size of the Federated Suns and its population means that even a fraction of a percent of its population radicalising is equivalent to tens of millions of people. Worse still, said movements have been quick to take advantage of the growing FTL comms network in the Federated Suns, media outlets founded by notoriously conservative politicians using the network to fan the flames.

    Driven to action by the growth of these movements, left-wing and centrist groups within the Federated Suns have responded by attempting to grow their own support bases, the former targeting students, workers, unions, etc., and the latter aiming for middle-class supporters such as lawyers, doctors, and more. Doubtlessly understanding the weakness of his nation's position better than the nobles of his court, First Prince Davion has reportedly responded to this increase in radicalism by quietly pushing for new media laws restricting the kind of hateful content which media outlets can broadcast via the FTL comms network. While far from exerting any real influence over the Federated Suns' politics—most of the extant conservative groups proving themselves dismissive of the newcomers—history has made clear that the increasing radicalisation of the FedSuns populace can only prove ill for the wider galaxy.


    Much to the irritation of Helghan ironmongers, who don't appreciate the competition, Q1 3050 saw the Federated Suns and Free Rasalhague Republic sign an arms deal to help feed the nation's ever-growing need for arms and armaments. Signed on credit in much the same way as the Helghan-Rasalahague deal, this new contract between Rasalhauge and the Suns will see a small but valuable stream of weapons, ammo, and drones delivered to the embattled state, the deal's capstone item being a FedSun suicide drone.

    Supposedly designed in under three months by the NAIS specifically for use against Clan battle armour, the loitering munition sold to the Free Republic—dubbed the Bodkin 200 thanks to its shape—is little more than a set of high-performance anti-gravity drives attached to a multi-kilo explosive warhead. Fired from a plastic launch tube reminiscent of a mortar and boasting enough battery power to speed to a battlefield and loiter over it for twenty minutes, the Bodkin 200 is easily transported and used by infantry. Better still, according to the sales brochure provided to the Republic by Rasalhague, Bodkins can be fired remotely by the infantry unit that set up their launchers, a design decision that allows said infantry to stay hidden from reprisal strikes.


    As expected, March 3050 has seen the Federated Suns continue its efforts to rebuild its shattered shipbuilding capabilities, Augusta and Numenor both seeing one of their 500,000-ton slipways restored to functionality. Worse still from the perspective of the ORDI's near-unchallenged naval dominance, work has continued apace on the Markesan and New Avalon shipyards and additional 200kt slipways on Augusta and Numenor.

    Likewise, mid-March saw the Federated Suns launch four more Reynard-class Guided Missile Corvettes, bringing the total size of the AFFS's fleet up to twelve such vessels. While these vessels do not represent a particularly potent force given their low mass budget, Helghan spies operating within the Federated Suns have reported that two Chevalier-class frigates will launch by June and that the FedSuns are close to completing work on another new design. Lacking any detail on the design, Helghan analysts have refrained from making any guesses regarding its effectiveness in combat; however, many within the Republic's military are concerned that the AFFS may have learned from prior mistakes and have cautioned leaders to expect the worst.


    Free Worlds League
    Continuing the shipbuilding frenzy that appears to have struck the Inner Sphere, the end of Q1 3050 has seen the Free Worlds League announce the completion of four ground-based shipyards within its territory, one each on Alterf, Atreus, Hellos Minor, and Regulus. Bringing the League's warship construction capabilities in line with the Lyran Commonwealth, League reporters were permitted to visit these four yards in a carefully orchestrated event for two hours before they shut to the public in the interests of national security. No doubt put to work building the first four examples of the League's navy, time will tell just what kind—or how many—warships the League plans to construct.


    Lyran Commonwealth
    With the invading Clans pausing on the threshold of disembowelling the Lyran Commonwealth, it came as no surprise when the LCAF took full advantage of the stay of execution by responding in an appropriately Lyran fashion. Launching a quick but conservative assault against the Diamond Shark and Coyote-held worlds closest to the Commonwealth's core, the LCAF crashed down on the invaders in a tide of steel, elite Lyran and mercenary units landing on eight worlds and bringing the war to the Clans. Their way cleared by the nation's four new warships and the Republic's pair of Nocti, the forces making up the counter-attack fell upon the Clanners without mercy or regard for the material losses sustained, a constant flow of mechs and equipment from Lyran factories ensured that units such as the 10th Lyran Guards, the 19th Arcturan Guards, and others were kept well fed despite loses.

    Quite to the relief of the Republic, who feared that this counter-attack might fail, such was the ferocity of the assault and the effectiveness of tactical orbital strikes that all but three of the targeted worlds returned to Lyran hands by the end of March. Though the fighting proved brutal and cost many lives—mercenary units such as the Kell Hounds and Grey Death Legion suffering many losses—the successful counter-attack appears to have bought the Commonwealth dearly needed time; ORDI spies reporting a great deal of movement by LCAF reserves even as the attack progressed. While information is scarce, reading between the lines of recent Lyran news broadcasts and reports from ORDI spies suggests that the LCAF plans to launch an even larger assault sometime in April.


    Draconis Combine
    Coming as a surprise to the Outer Rim Defence Initiative and the wider galaxy alike, Q1 3050 saw the Draconis Combine refrain from launching a counter-attack on the nearby Jade Falcons and Nova Cats. Though the exact reasoning behind this decision remains out of reach of the Helghan Republic, a lack of spies preserving much of the Combine's famed opacity, agents within the Federated Suns and reports from the Republic's seconded Nocti suggest that the state seeks to take advantage of the Clans' torpor; said reports detailing considerable effort spent to rebuild shattered units, refill expended stockpiles, and redeploy remaining reserves. No doubt a decision that cost the Coordinator many sleepless nights before the Clans' stasis became fully apparent, armchair commentators and ORDI analysts both expect the DCMS to launch a wide-scale attack sometime next quarter.


    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship )

    Support Modifiers
    Navy    :
    • +2 (Make-Do Yardships)
    • +3 (Tsitsang Fleet Anchorage)
    • +5 (Decreased Distance)
    • +2 (Parthian-class Mobile Shipyard)
    • -2 (ORDI Donation)
    Ground Support Capacity:
    • +1 (Tsitsang Ground Facilities)
    • +0.25 (Fort Loudon)
    • +0.50 (Decreased Distance)
    • +1 (Forge Pack)
    • +0.50 (Forge Pack)
    • +0.25 (Forge Pack)
    • -1 (ORDI Donation)

    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 16/16 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.2/3.25 [Base: 0.75] (use the transport size value)
      Navy (11/16 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 32 Commissar-B Pocket Warships (0 capacity)
      Ground (2.4/3.25 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight) [85% health]
      • 0.5 of Fourth Division, First Army (0.25 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 3 Carson II-class Frigate (3 Capacity)
      • 1 Carson II-class Frigate (1 Capacity) [Q2 3050]
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 3 Auroch-class Frigate (3 Capacity)
      • 1 Auroch-class Frigate (1 Capacity) [Q2 3050]
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships


    Q1 Casualty Estimates
    CasualtiesTotalKilledInjured
    Helghan Republic Armed Forces581155426
    Aurigan Coalition Military32386237
    Taurian Defence Force28175206
    Magistracy Armed Forces29679217
    Capellan Confederation401107294
    Clan Invaders (Est.)800300500
    Civilians (Est.)8,4002,1006,300


    Casualties To Date
    CasualtiesTotalKilledInjuredMissing
    Helghan Republic Armed Forces4,4331,2092,651573
    Aurigan Coalition Military2,1205201,53862
    Taurian Defence Force3,35910122,204143
    Magistracy Armed Forces3,2999152,226158
    Capellan Confederation4,0211,1492,764108
    Clan Invaders (Est.)9,1004100+5000+--
    Civilians (Est.)101,60032,900+68,700+--

    Map of the Inner Sphere (End of march, 3050)

    Updated Info Posts

    Helghan Republic

    The Lords of Ruin -- Battletech/Killzone Crossover

    Helghan Republic: Current Date: 3050 General Stats: Population: 3.70 Billion Recruitable population: 35.3 million out of 37.0 million. Stability: 99% War Support: 83% Recruitable Pop Percentage: 1% Action Points: 18 (+2 from Spencer and Cassilda joining when High-Gain Tranceivers is...
    forums.sufficientvelocity.com

    Helghan Republic Order of Battle

    The Lords of Ruin -- Battletech/Killzone Crossover

    Helghast Order of Battle: Doctrine: Super-mobile blitzkrieg doctrine based around deploying divisions via ship-based dropships and cruisers. Navy...
    forums.sufficientvelocity.com
     
  • View discussion
    • The Clan Invasion -- April-June 3050 Actions
  • View content
    • Hearts of Silicon
    With cybernetically augmented troops having repeatedly proven their worth in conflicts such as the Mandate Intervention, the Outback Intervention, and, now, the Clan Invasion, early 3050 saw Republic military minds once again turn their thoughts to the idea of expanding the nation's cybernetic resources. Initially only open to the Republic's special forces units due to concerns regarding the policing of cybernetically enhanced troops as well as the potential impacts of augmentations on mental health, the recruiting pool for cybernetically augmented troops had quickly expanded to encompass the general military population in response to the increasing need for kinetic operators. Though able to meet the needs of the Republic for a time, the Clans' arrival to the Inner Sphere saw the need for cybernetic troops skyrocket almost overnight, and Operation Santiago's desire for stay-behind troops able to contest the Clans fearsome Elementals has seen the two regiments maintained by the nation steadily drained.

    Faced with the possibility of no longer being able to provide insurgencies and spy groups behind the lines of the invasion with muscle, many figures within the Republic have once again raised the idea of expanding recruitment to include the general public. Consisting of both civilian figures and military personnel, proponents of the move have repeatedly pointed to the largely incident-free history of the Republic's cybernetic corps as evidence of the program's safety; the half-decade-long history of the branch seeing only a few minor incidents occur between cybernetically augmented personnel and ordinary humans. Similarly, those same people have claimed that the small scale of the nation's cybernetic forces has limited their utility to merely being a supporting asset to Helghan intelligence operations, whereas an expanded corps could find uses in everything from Battlemechs to Aerospace fighters.

    In contrast, critics of the idea have suggested that it is only because of the program's small size that it has been so successful at preventing untoward incidents between those with cybernetic limbs and those without; a few regiments of cyborgs a small enough pool of individuals that the Republic can feasibly place every potential candidate under intense scrutiny for signs of psychological fracture points and concerning political inclinations. Given the high profile of the cybernetics corps within the public consciousness—a natural consequence of their mystique and lethality—said critics believe that opening recruitment to the general public would see recruitment services inundated with applications, overwhelming those charged with screening potential recruits and dramatically raising the chances of some terrible incident occurring. Something of a theoretical concern given existing history, the thought of a psychologically unstable augmented trooper undergoing a mental break in public is not one many in the Helghan government wish to contemplate.

    Does the Republic open cybernetic recruitment to the general populace?
    [] Yes
    [] No

    ATGCACCTGTAGTAGCTACTCAGCCTGCTCAGCCATATCTGTTGTTAC
    Arising in response to a request from the Canopians, the first days of April 3050 saw the Republic's ruling government forced to debate the merits of granting Canopian geneticists access to the prisoner-of-war camp on Cassilda; the Helghan government finding itself split into two nearly even halves in a matter of hours. Intrigued by the possible impacts of long-term genetic manipulation on a populace and the specific alterations made by Clan scientists, numerous Helghan politicians and other public figures have quietly signalled their support for the geneticists' actions, the surprisingly broad coalition consisting of those who wish to better understand the Clans and those who wish to take advantage of a present resource for the betterment of humankind. Acknowledging that any scientific benefits are likely to be a long time coming, members of this coalition are nonetheless steadfast in support of the idea and consider the potential benefits well worth the security risks concerns raised by their opponents.

    Speaking of, members of said opposition are similarly steadfast in their belief that granting Canopian scientists access to Clanners is the equivalent of sending sheep into the wolves' den. While granting that the potential scientific benefits of the study are substantial, assuming the geneticists' promises pan out, they nonetheless consider the potential for a hostage situation or some other kind of incident too high to be worth the gains promised and oppose the idea.

    What does the Republic do?
    [] Grant them access to the facility
    [] Refuse access due to security fears


    Actions
    You have 6 out of 10 Action Points to spend. -1AP from Tikonov Command Circuit rental. -1AP from Free Worlds League Command Circuit rental. -1AP from Trinity League security force commitment. -1AP from Ani-Clan AgitProp effort.
    This list of available actions is by no means exhaustive, so feel free to suggest more actions or variations on the actions listed below.

    Federated Suns:
    [] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Stage diplomatic incident [Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/12 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Continue NAIS Infiltration [Medium-Hard]: Continuing prior efforts to infiltrate the New Avalon Institute of Science is vital if we want access to their latest designs and most secure production sites.
    [] Steal research [Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Infiltrate Davion Palace [Hard]: By infiltrating the Davion palace, we can gain access to its most vital secrets and most important people.
    [] Write-in:

    Lyran Commonwealth:
    [] Expand Lyran intelligence network: Having placed a large number of agents within the lower levels of Lyran society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Medium]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Steal research [Very Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Very Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]

    Free Worlds League:
    [] Expand League intelligence network: Having placed a large number of agents within the lower levels of League society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Hard]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Extremely Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in (Convince me you've got something good)

    Draconis Combine:
    [] Arms Sales: With the Combine now at war, they may be willing to purchase items up to and including formerly LosTech ammunition from the Republic. Given the distances involved, such shipments will be very difficult until efforts are made to improve the backend logistics. [-5 influence]
    [] Tech for Tech: By offering the Combine information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.
    [] Expand Combine intelligence network: Having placed a number of agents throughout Draconis society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Impossible]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-15,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in

    Trinity League:
    Unrest in the Former Trinity League: Low
    League Self-Governance: None
    [X] Commit Security Forces: Once the responsibility of those the Republic has since ousted/bribed to leave, the former Trinity League is bereft of security forces. Temporarily deploying Helghan security forces, while only a stopgap, will almost certainly help local police keep a handle on things. [Progress: 2/3]
    [] Fate of the Trinity League (Write-In): With the former rulers of the Trinity League either deposed or enjoying a relaxing vacation with their newfound wealth on the planet of their choosing, the question remains "What does the Republic wish to do with the systems of the former Trinity League?" [Note: This will unlock further options depending on what you do]

    Capellan Confederation
    [] Tech for Tech: By offering the Confederation information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.

    ORDI Actions
    [] Write-in

    Helghan Republic
    [X] Establish a continuing effort to provide propaganda relating to the Clan war effort [Ongoing]
    [] Establish Battle Armour Production: Requiring many specialist components and manufacturing processes to construct and support, the deployment of battle armour to Republic units will require the creation of dedicated manufacturing centres and logistics pathways before it is practically feasible on any scale.
    [] Construct a military defence station over [LOCATION]
    Locations available:
    • Cassilda
    [Can be taken multiple times in a turn]
    [] Upgrade a military defence station at [LOCATION]
    • Available stations:
    • Caliban (Medium → Large)
    • Charybdis (Medium → Large)
    • Highwater (Medium → Large)
    • Mir (Medium → Large)
    • Tiverton (Medium → Large)
    • Contrilla (Small → Medium)
    • Detroit (Small → Medium)
    • Mantharaka (Small → Medium)
    • New Oslo (Small → Medium)
    • Rogue (Small → Medium)
    • Spencer (Small → Medium)
    [Can be taken multiple times in a turn, but you can only upgrade a single station once per turn]
    [] Construct a Petrusite synthesis plant on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Helghan
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]
    [] Construct a secondary fleet anchorage on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]

    Military
    [] Raise an Army: Task your military with forming an additional army. [Progress: 0/2] [Can be taken multiple times in a turn so long as there is recruitable population remaining]
    [] Construct two Hasta-class cruiser Squadrons: Task your shipyards with constructing three Hasta Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIIC-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIIC Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIID-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIID Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct one Noctis-class cruiser Squadrons: Task your shipyards with constructing six Noctis Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Damascus-Class Carrier Squadron: Task your shipyards with constructing a squadron of Damascus-Class Carriers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Toxotai-class Guided Missile Cruiser Squadron: Task your shipyards with constructing a squadron of Toxotai Guided Missile Cruisers. [Progress: 0/3] [Can be taken up to four times in a turn]
    [] Construct 4 Guardsman-class Pocket Warships: Task your shipyards with constructing 4 Guardsman-class pocket warships. [Can be taken multiple times a turn]
    [] Construct a Pilum-class Battlecruiser squadron: Task the Detroit shipyards with building a squadron of three Pilum-class battlecruisers. [Progress: 0/6] [Cannot construct other 1m+ ton designs until completed]
    [] Hecatoncheires-class Escort Carrier Squadron: Task your shipyards with constructing a squadron of Hecatoncheires-class Escort Carriers. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a MAWLR-II pack: Task your heavy industry with constructing a pack of three MAWLR-IIs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a SAHLR pack: Task your heavy industry with constructing a pack of three SAHLRs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Hydra pack: Task your heavy industry with constructing a pack of three Hydras. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Dragon pack: Task your heavy industry with constructing a pack of three Dragons. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Pyrrhus pack: Task your heavy industry with constructing a pack of three Pyrrhuses. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct 2 Battlemech Battalions: Task Fisher & Zulim Taw with constructing 2 battalions worth of mechs.

    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.
    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship )
    Support Modifiers
    Navy    :
    • +2 (Make-Do Yardships)
    • +3 (Tsitsang Fleet Anchorage)
    • +5 (Decreased Distance)
    • +2 (Parthian-class Mobile Shipyard)
    • +2 (ComStar Command Circuit Route)
    • -2 (ORDI Donation)
    Ground Support Capacity:
    • +1 (Tsitsang Ground Facilities)
    • +0.75 (ComStar Command Circuit Route)
    • +0.25 (Fort Loudon)
    • +0.50 (Decreased Distance)
    • +1 (Forge Pack)
    • +0.50 (Forge Pack)
    • +0.25 (Forge Pack)
    • -1 (ORDI Donation)

    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 16/18 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.2/4.0 [Base: 0.75] (use the transport size value)
      Navy (11/16 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 32 Commissar-B Pocket Warships (0 capacity)
      Ground (2.4/3.25 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight) [85% health]
      • 0.5 of Fourth Division, First Army (0.25 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 3 Carson II-class Frigate (3 Capacity)
      • 1 Carson II-class Frigate (1 Capacity) [Q2 3050]
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 3 Auroch-class Frigate (3 Capacity)
      • 1 Auroch-class Frigate (1 Capacity) [Q2 3050]
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships


    [] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessel's to Clan-held regions will improve the ORDI's ability to gather information substantially.
    [] Prioritise Naval Supplies: By prioritising the shipment of naval supplies over those for ground troops, we can further improve our ability to deploy naval forces to the Outback. [+1 Naval Support Capacity, -0.125 Ground Support Capacity]
    [] Prioritise Ground Supplies: By prioritising the shipment of supplies for ground troops over those of the navy, we can further improve our ability to deploy ground forces to the Outback. [+0.25 Ground Support Capacity, -0.5 Naval Support Capacity]
    [] Operation Santiago Phase 6 Objectives (Failure to detail new objectives for Operation Santiago will have me pick ones based on prior discussion) [You can have a max of 300 words and 2 if statements in this action.]

    Military Requisition And Design

    You have 4 out of 4 Requisition Points to spend on upgrading Helghan's ground forces. These upgrades are given to all active armies at once, though the more armies you have the longer it'll take to roll out changes.

    Requisition
    [] HSA-49 'Skandia' Gauss-Powered HMG: Both named in celebration of the (in)famous victory on Skandia during Clan Invasion, and as a sign of respect for the personal bravery in the face of near certain death of Clan Smoke Jaguar's warriors, the Skandia Gauss HMG was released for mass production and distribution to both the Republic's regular armies and National Guard units. Designed by Helghan State Arms initially as a crew-served weapon, even with PAL, a tripod mount would have been required to achieve firing stability. However, with the creation of the Republic's first native BA designs, tests have shown that the weapon can be hip or shoulder-fired by Battle Armor as well.

    Design
    [] Dropship Design: (tell me what you're trying to design)
    [] MAWLR Redesign: Order your design teams to redesign the MAWLR to make use of the latest technological advancements.
    [] Design write-in: Order your teams to design a solution to a capability gap. (tell me what you're trying to design)
     
    Last edited:
  • View discussion
    • The Clan Invasion -- April-June 3050 Results
  • View content
    • [X] Plan: Chrome, Blood and Gold
    https://forums.sufficientvelocity.com/threads/the-lords-of-ruin-battletech-killzone.52819/page-1085?post=31697580#post-31697580

    Hearts of Silicon
    [X] No
    Despite the initially even split between those who wished to expand recruitment of cybernetically augmented soldiers and those critics who thought the risks outweighed the benefits, the March-April transition saw more and more members of the Gemini government side with the latter in response to the litany of risks presented to them throughout the debate. Confronted with compelling arguments regarding the Republic's ability to scrutinise and police cyborg troopers—one popular example proving a cyborg with a semi-secret drinking problem—it took Helghan's government only a few weeks to settle the matter, the proposal to expand recruitment voted down by a considerable margin by April 12th. Though a disappointing result to many of the project's backers, not least those who invested a great deal of political capital in its success, said backers were able to console themselves with the knowledge that they could always try again in a year or two; mid-April seeing the loose coalition that made up the pro-cyborg side of the debate start laying the groundwork to relitigate the matter even as the Republic's parliament moved on to consider other topics.

    Effect
    • The Republic votes to keep cyborg troops as they are.
    • The pro-cyborg faction gets ready to annoy everyone by litigating the matter sometime down the track

    ATGCACCTGTAGTAGCTACTCAGCCTGCTCAGCCATATCTGTTGTTAC
    [X] Yes
    Intrigued by the Canopian doctors' ideas and with the expansion of cyborg recruitment already denied, if only temporarily, April's first few weeks saw the ruling government immediately turn to debate granting access to Clan POWs. Well aware of the Clan's experience with genetic engineering— in large part thanks to the constant barrage of boasting made by even comparatively sympathetic POWs, but also due to prior interviews with Clan medical personnel—many within the Gemini government proved eager to pounce on the idea of studying the long-term effects of genetic manipulation; the thought of Helghan's populace benefiting from the knowledge unstated, but well understood by all involved. A powerful and influential bloc, this group was nonetheless opposed by those who, while accepting of the potential benefits, believed that permitting the Canopians access would represent an unacceptable risk to their safety and the overall security of the Cassildan facility. Not unsympathetic to their concerns, it took only a short time before the two blocs devised a compromise solution—the Republic informing Canopus that its scientists were welcome to carry out their study and retrieve whatever samples desired, so long as they followed a list of simple security procedures and obeyed all directions by camp personnel.

    As hungry for the data as Helghan was, the Canopians agreed to the rather understandable terms without a quibble; their scientists soon dispatched to Cassilda aboard a fast cutter.

    Effect
    • Republic agrees to allow Canopian scientists access to the Cassildan POWs with reasonable caveats.
    • Long term, maybe something useful will come of it.

    [X] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalize on the effort and expand the Republic's reach.
    "Lark calling Nest. Repeat: Lark calling Nest. Skies are clear; no hawks in sight. Resuming activity." - Codename LARK renewing contact.

    With the situation in the former Outback growing more concerning with every passing day, evidence suggesting FedSun involvement in said worsening situation, and reports from the Suns' interior describing a growing right-wing movement among politicians and the common folk, Helghan's government found its attention turned away from the Clan Invasion just long enough to divert additional resources towards infiltrating its coreward rival; orders cut within days of the second quarter's start. Trained in the ins and outs of the Suns' culture and with substantial aid provided by extant networks of agents and their assets, the April-June period saw well over a dozen Republic operatives slip over the border and into the Federated Suns proper, fabricated histories providing them with a near unquestionable right to be there and untraceable C-Bills covering the rest. Arriving in the nation without a ripple of alarm, these agents quietly manoeuvred themselves into position to take over those roles left vacant by better-established agents as they rose to more sensitive roles within the Suns' government, and the interstellar-scale shell game saw Republic intelligence organs expand their reach substantially by the time June came to a close.

    Effect
    • Success
    • Infiltration raises a step, giving you access to additional information and actions.

    [X] Deepen penetration into Neo-Jacobin circles, find proof of their collusion with the Federated Suns or otherwise gather intelligence on their actions in the URC.
    In total contrast to the Republic's successes in the Federated Suns, Helghan efforts to infiltrate the Neo-Jacobins met with complete failure despite the pressing need to confirm the recent determination of FedSun involvement in Jacobin politics and the substantial resources put to that end. Successfully crossing the border into URC space and arriving on Jacobin-held planets with significant assistance from the region's disunity and political gridlock, Helghan agents reported green lights on all their infiltration efforts and quickly received the go-ahead to penetrate deeper into the Jacobins' organisational structure, the ultimate goal being to gain hard evidence of FedSun involvement with the movement's higher-ups. Unfortunately for the Republic, though its agents' reports were initially encouraging—the time spent studying the movement's vast corpus of works proving well worth the effort—satisfaction in their success soon turned to alarm when the stream of reports ceased almost overnight and the Republic's agents vanished from sight.

    Undoubtedly the result of counter-intelligence activities, the sudden disappearance and presumed capture of multiple Helghan spies prompted a flurry of activity within the Gemini government the moment the news arrived, a dozen plans drawn up to disavow any claims by the Jacobins even as arguments raged as to who detected the Republic's spies and how; several figures arguing that the Jacobins got lucky—or the Republic got complacent—while others have argued that they received assistance from the Federated Suns. Regardless of exactly how the situation occurred, all within the Republic's intelligence services and government have been left waiting for the other shoe to drop.

    Effect
    • Attempt to infiltrate the Neo-Jacobins fails badly with a handful of spies captured, though presumably still alive given the value of captured spies.
    • The Jacobins have yet to say anything about the spies.

    [X] Commit Security Forces: Once the responsibility of those the Republic has since ousted/bribed to leave, the former Trinity League is bereft of security forces. Temporarily deploying Helghan security forces, while only a stopgap, will almost certainly help local police keep a handle on things. [Progress: 2/3]
    "On Jia Tian, the cooks are Capellan, the police are Helghan, the mechanics are Taurian, the lovers are Canopian, and the drivers are Aurigan…" - Anonymous, circa 3050s

    Continuing from earlier efforts, 3050's second quarter saw Republic security personnel redouble their efforts to assume control of security roles throughout the former Trinity League, each passing day seeing fewer and fewer responsibilities left in the hands of the local police by local governments eager to transfer them into the Republic's purview. Vastly more visible than the region's previous secret police forces and held to higher than usual levels of accountability thanks to perception-conscious superiors concerned about touching raw nerves, the sterling reputation of Helghan security personnel maintained its lustre among the region's people despite the Republic all but completely supplanting local police as the primary provider of security; the sight of Helghan police commonplace by June's opening. To the relief of those overseeing the program—and as something of a surprise under the circumstances—far from resenting this replacement, the police forces so affected proved almost deliriously grateful for the opportunity to recuse themselves from the task; the police finally able to rebuild from the grievous structural wounds suffered during and after Operation Telemachus.

    [Progress: 2/3] → [Progress: 3/3]

    Effect
    • Helghan security forces finish taking over most security roles.
    • Local police are now in the process of rebuilding and will no doubt be easy to influence.

    [X] Commit to, and convince ORDI and Rasalhague planners to contribute toward, an increase in strategic depth to the situation in the FRR, and construct a forward production point on an appropriate world within the region where arms and munitions can be transferred from factory to Initiative soldier at best speed. There is no guarantee the situation in the Commonwealth won't deteriorate or that the Wolves won't make further gains in the future.
    "We cannot outfight the Clans unless, at the same time, we outproduce them locally. It is not enough to transport just a few more bombs, a few more bullets, a few more guns, or a few more parts than can be brought to bear by our enemies. We must produce them in the Free Republic so overwhelmingly that there can be no question of our ability to provide a crushing superiority of equipment in any theatre in the Clan Invasion. To that end, our government has reached out to Elected Prince Magnusson and secured the cooperation of his nation in this endeavour." - Prime Minister Gemini Malkiewicz, speech to parliament, 02/04/3050.

    Wary of the proximity of Clan forces to forward production sites such as Fort Loudon and with the Free Rasalahague Republic suffering from a distinct paucity of industrial capacity due to earlier losses, Q2 3050 saw several notable figures within the Republic military push for the construction of much-needed factories within the Free Republic; their proposal soon adopted by the Gemini government within weeks of being raised. Quickly realising that the initial proposal of something on the scale of Tsitsang would be almost impossible to achieve even in peacetime, the Gemini government soon pared the idea back to its bare essentials, round after round of investigation and revision reducing the proposal to a much more reasonable but still ambitious plan to construct a supplementary Fort Loudon-esque factory on a world deep behind the Gunzburg line. A workable idea now in mind, mid-April saw the Republic's government pass on the idea to the Rasalhagian Riksdag via HPG—ComStar once more proving its worth by providing priority routing to both sides—as well as with its allies in the ORDI.

    Eternally hungry for support against the invading Clans, spending vast amounts of weapons and ammunition on raising additional regiments, and with the Republic having earned a great deal of goodwill thanks to its actions, the Riksdag itself proved more than happy to back the idea of an ORDI built support factory; the Coreward parliament offering to site the factory on Lothan, though unable to provide meaningful support to assist in its construction. Meanwhile, the Republic's allies in the Outer Rim Defence Initiative were rather more hesitant to support the idea, all five member-states quietly sharing reservations regarding the sheer amount of resources such a construction/upgrade effort would absorb and the impact it would have on Operation Santiago's ability to conduct offensive operations. However, despite these initial doubts, a shock and awe campaign by Helghan diplomats that ran until the end of the quarter combined with the sheer goodwill earned by the Republic's industry over the past decade saw all five eventually come around to the idea—though only the Capellan Confederation proved to be in any position to materially support construction.

    Effect
    • Takes a whole quarter, but they agree. Rasalhague agrees to site it on Lothan but expects it'll be hellaciously expensive to produce.
    • Work begins next turn on the Lothan factory complex (0/10 Progress with the CapCon providing +1AP and multiple choices available to trade Ground and Space supply cap for progress)

    [X] Establish Battle Armour Production: Requiring many specialist components and manufacturing processes to construct and support, the deployment of battle armour to Republic units will require the creation of dedicated manufacturing centres and logistics pathways before it is practically feasible on any scale.
    "How much fucking shit is there on the menu, and what fucking flavour is it?" - Melissa Ketill, Quality Control Lead, Mount Koshtan-Tau Battle Armor Plant, Day Seven.

    Following the recent perfection of battle armour by Capellan scientists and the technology's subsequent sharing with the rest of the Outer Rim Defence Initiative, Q2 3050 saw the Gemini government beset from all sides with demands for the ultra-heavy powered suits; the need for a counter to the Clans' infamous Fleas lending the calls an edge keenly felt by all. Well aware that the Republic's existing power armour designs—having already earned the designation Power Armour (Light) in the face of the Clan Invasion—were imperfect solutions to the problem posed by the Clans' heavily armoured infantry, Prime Minister Malkiewicz and the rest of their party quickly found the pressure almost irresistible, the Republic parliament passing an emergency funding measure within weeks of April's start and ordering the construction of manufacturing centres and supply lines for the highly advanced suits. Fueled by the many millions of Marks and backed up by supreme political interest, construction of the manufacturing plants began almost the same day the funding bill was signed, with work on feeder factories and their feeder factories following soon after.

    Absorbing a notable fraction of the planet Helghan's industrial output for three months, the wartime task progressed both impossibly swiftly and agonisingly slowly in the minds of Republic politicians, the need for the armour growing with every Helghan body that returned from the frontline. However, seemingly answering the increasingly strident calls for an answer to the Clans' battle armour, June saw work finish on the planned battle armour production facilities, the small-batch facilities coming online as the month's end rapidly approached, and starting test runs for quality assurance. Unfortunately for those who hoped for an immediate ramp-up to full-scale production, these same test runs soon revealed substantial flaws in several of the new manufacturing processes introduced in the construction of battle armour—everything from unreliable electronics to warped structural components and brittle armour plates afflicting the production lines.

    Arriving at the end of the quarter with a number of manufacturing centres suffering production issues ranging from the irritating to the outright dangerous and an ever-intensifying war to galactic north, the Republic's leaders found an uncomfortable decision lying ahead of them.

    Effect
    • Process to establish production sites goes well, but the test runs reveal an unexpectedly high number of components suffering from manufacturing flaws.
    • Choice next turn about what to do about it.

    [X] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessel's to Clan-held regions will improve the ORDI's ability to gather information substantially.
    Much to the relief of those involved in the decision-making behind the flawed establishment of battle armour manufacturing in the Helghan Republic, Helghan efforts to disperse spy ships throughout Clan-controlled space achieved quietly successful results; thirteen Hyde-Class vessels travelling to Rasalhagian space via the ORDI Command Circuit before making their way to an equal number of Clan-held systems.

    Constructed in top secret shipyards across Helghan and filled to bursting with sensor and computing systems able to spin gold from the merest scraps of data, the eight thousand-ton vessels boasted some of the most advanced automation and communication technology ever devised by Helghan scientists, as well as the smallest warp drive in existence and a crew of sixty drilled in the ins and outs of civilian trade practices. Intentionally designed to resemble the Republic's Jekyll-Class Warp Courier—or rather, with the Republic's Jekyll-Class Warp Courier intentionally designed to resemble the Hyde-Class Surveillance Vessel—the thirteen Hyde-class vessels jumped into the outer reaches of their target systems before slow-boating into position on minimal thrust, the crews' cautious approach and the thick layer of stealth paint applied to the vessels for this deployment rewarded by an absolute dearth of alarm from occupying forces.

    Arriving without incident at their chosen deployment zones a mere month after warping into their respective systems, the cluster of spy ships deployed their sensors without undue haste and drank deep from the wealth of data radiating out from the inner system; receivers in Operation Santiago's headquarters soon chattering to life with coded messages...

    Effect
    • Deployment goes very well with a dozen spy ships deployed throughout Clan-occupied space and transmitting data back. No indication that the Clans are aware of them.

    [X] Operation Santiago Phase 6 Objectives
    -[X] Deploy the Pilum Battlecruiser awaiting orders at Tsitsang along with accompanying shielded Commissars, to serve as a Flag Vessel for the operation. Deploy the other half of Fourth Division to the front, an additional MAWLR-II and one additional Battlemech regiment.
    -[X] Keep pressing the Wolves, securing worlds at military planners on the front's discretion in accordance with the previous strategy of our goal to secure the FRR-LC border worlds currently held by Clan Wolf from Rasalgethi to Laurent, running as far west as Benfled.
    Eager to continue the already successful counter-attack against the invading wolves, the April-June period saw Operation Santiago's leadership ramp up attacks against the invaders—Domain, Suk, and La Grave all targeted for assault by leading elements of the ORDI assault. Setting forth with overwhelming numbers and equally overwhelming firepower, including several warships and multiple garrison troops from the Free Republic, these forces crashed down upon their enemy with little warning and equally little mercy; the skies of all three worlds soon filled with streaking fireballs as ORDI units made landfall and engaged their enemy. Though far from inclined to surrender, it took a little over a week for the Outer Rim Defence Initiative to crush the wolf presence on Domain and Suk, dogged resistance no match for the sheer amount of force arrayed against them and both worlds liberated by the time April drew to a close. On La Grave, the wolves faired a little better, with clever tactics and grim determination allowing the 341st Assault Cluster to make true the system's name for many of the liberators, though ultimately falling under ORDI guns just the same.

    Surging past these apocalyptic struggles, other elements of the counter-attack struck out against Rastaban, Montmarault, Shaula, and Benfled, reinforcements from the Helghan Republic and its allies joining them mere days from combat. As in the prior quarter, the wolf defence of these systems shattered almost immediately under the forces arrayed against them; only those warriors in the 3rd Battle Cluster able to put up notable resistance. Engaging ORDI forces attacking Montmarault with unrelenting aggression from before they landed until the conclusion of the invasion, the 3rd Battle Cluster under the command of Star Captain Warwick proved its boasts more than braggadocio, the mere act of defeating them proving comparatively painful considering the resources deployed against them. Nonetheless, mid-June saw the quartet of systems fall under ORDI control, the savaging of the Wolves on Benfled by the Black Widow Battalion seeing the mercenary unit gain a substantial supply of Clan technology and prisoners thanks to the rules of Zellbrigen.

    Concurrently with the twin assault, the April-June period saw Commodore Ostergaard order a series of deep penetration raids against the Clans' supply convoys heading to and from the frontlines. Though negatively impacted by the number of warships seconded to Plan Cascade—the ORDI's attempt to force a decisive battle with Clan Snow Raven's Blackwater navy— and the defensive needs of the counter-attack, the addition of Hyde-class Surveillance Vessels to the list of intelligence-gathering assets in the region allowed the assembled strike forces to maximise the damage dealt. Launching before the first strike landed on Domain, the ORDI warships ran roughshod over several Clan supply convoys for several months; a Wolf Vincent Mk. 42. destroyed outright, and a Coyote Liberator fleeing after sustaining heavy damage.

    Effect
    • Reinforcements come in
    • Suk, Domain, La Grave, Rastaban, and Montmarault are all captured, albeit with heavy losses due to the ferocious resistance.
    • Wolf Dragoons take Shaula and Benfled with ORDI support, capturing even more clan gear for themselves.
    • Convoy raiding goes very well. One warship destroyed, one forced to flee after taking heavy damage.

    [X] Navy is to utilize intelligence from deployed satellites and spy ships and, if possible, to either goad or force Snow Raven into committing to battle, destroying Snow Raven or other Clanner naval assets in the region which present themselves as targets of opportunity. If possible, request the Draconis Combine to allow vessels posted there to coordinate with this effort.
    "FLASH MESSAGE: HNS AURORA TO SANTCOM

    DOG WON'T HUNT. REPEAT. DOG WON'T HUNT. MOVING TO SECONDARIES."     - Captain Daniel Isakov, HNS Aurora, report to Commodore Ostergaard, 23/06/3050

    Not content with only continuing the assault against Clan Wolf holdings in the Inner Sphere, 3050's second quarter saw Commodore Ostergaard and the rest of the man's staff enact plans for a major naval operation against the Snow Raven's Blackwater assets, April's first week seeing dozens of senior officers and hundreds of analysts brought together to devise what soon became Plan Cascade. Relatively simple in concept, Cascade's first goal was to identify vital Snow Raven resources that the Clan must defend with warships, the ORDI subsequently jumping any such defenders with overwhelming force. Intended as a knockout blow against the Snow Raven's naval capacity and their store of warship-grade Petrusite weaponry, Plan Cascade's success would also permit ORDI warships freedom of action against the eugenicist invaders and greatly hasten the conclusion of the invasion.

    With the Plan Cascade conceived, developed, and perfected by early June, the days following saw Commodore Ostergaard approve its launch, the vast wheels of military bureaucracy slowly grinding to life to send orders and communiqués all across the Coreward Inner Sphere even as the counterattack against the wolves continued.

    Unfortunately for the Republic, the first sign that Plan Cascade would prove less than successful occurred when the Draconis Combine politely declined to allow the quartet of Nocti operating in the nation to be removed from patrol duty. Returned from the highest levels of the Combine's government with all the politeness and dissembling such a thing entails, the Combine's reply acknowledged Cascade's potential value in evening the playing field but pointed to the likelihood of a resumed Clan offensive as to the reasons behind their answer. Lacking any warships of their own and facing off against multiple Clans simultaneously, the Combine would naturally suffer if the Clan Invasion were to resume in earnest and the warships were out of position. Irritated by this response but unwilling to push the Combine lest the recently elevated Coordinator find himself forced to do something rash, Commodore Ostergaard ordered the matter closed, the attention of those involved in Plan Cascade turning towards identifying a target so valuable the Snow Ravens would be forced to defend it.

    However, once again, fortune turned its gaze from the ORDI.

    Despite having left numerous stay-behind troops on ORDI worlds, despite the assistance of Rasalhagian spies, and despite the observation satellites and Hyde-class Surveillance Vessels deployed to gather intelligence on Clan activities in the region, ORDI analysts found themselves singularly unable to identify a target of such surpassing value that Clan Snow Raven would have to defend it with warships. Working feverishly as the weeks dragged on and the cutoff date to launch the attack approached, ORDI analysts poured over terabytes of data in vain as they struggled to identify a target that was both extremely valuable and in a position to be hit by warships. Unfortunately for the ORDI, the sole product of their work proved to be an above-average-sized convoy—presumably containing reinforcements or spare parts from the Clans' homeworlds—spotted en route to the frontlines.

    Already suspecting that he knew what the Snow Raven's response would be, Commodore Ostergaard nonetheless approved the attack against the convoy, a pair of Nocti catching the vessels in the last leg of their journey and blasting apart many of them with impunity, Snow Raven warships nowhere to be seen.

    Effect
    • Combine politely but firmly ask the ORDI not to pull away the warships guarding its world. ORDI agrees to leave it be.
    • Spy resources fail to identify a particularly vulnerable target, ORDI instead goes for a bigger than usual convoy.
    • Snow Ravens refuse to take the bait. :(

    Design and Requisition
    [X] HSA-49 'Skandia' Gauss-Powered HMG: Both named in celebration of the (in)famous victory on Skandia during Clan Invasion, and as a sign of respect for the personal bravery in the face of near certain death of Clan Smoke Jaguar's warriors, the Skandia Gauss HMG was released for mass production and distribution to both the Republic's regular armies and National Guard units. Designed by Helghan State Arms initially as a crew-served weapon, even with PAL, a tripod mount would have been required to achieve firing stability. However, with the creation of the Republic's first native BA designs, tests have shown that the weapon can be hip or shoulder-fired by Battle Armor as well.

    [X] Antigravity Mounts and Gun Carriages: Ranging from anything between simple antigravity hover platforms with rudimentary targeting instruments, to fully automated mobile turret systems with remote control features, this ancient pre-spaceflight Terra concept allows infantry to operate battlemech and vehicle-scale weapon systems without having to rely on said war machines. While nothing revolutionary or particularly advantageous for the Republic, it does still provide both the Regulars and National Guard an additional, albeit last-ditch, defense option. For the Free Rasalhague Republic, however, this development will allow ORDI to furbish the Kungsarme with portable mech-scale weapon systems operable even by basic infantry. These platforms will allow both power-armored and regular troops to redeploy or transport impromptu field guns and heavy weaponry with relative ease and in quick fashion, whether in advance, or in retreat, or even being slotted into prepared, defensive positions and ambush points. More sophisticated variants, such as long-ranged autocannon can even be slaved to nearby targeting systems or even allied vehicles and mechs to coordinate attacks. While also feasible, energy weapons are noted to require extreme care, or even power armor, to use, as the generated heat can only be managed by venting, measures required to achieve firing stability. However, with the creation of the Republic's first native BA designs, tests have shown that the weapon can be hip or shoulder-fired by Battle Armor as well.

    [X] Javelin 1H Suicide Drones: Blatantly copying, and then iterating and improving, upon the concept recently introduced by the Federated Suns, the Javelin 1H anti-gravity drone is capable of being fired from a shoulder-mounted launcher or from slaved firing apparatuses mounted to CVs or hardpoints using systems integrated with either the vehicle, mech, and power armor, or a more rudimentary control system. The key difference is variable warheads as with many Helghan munition designs, the crowning loadout being one of Petrusite, seeking out enemy vulnerabilities for a devastating blast to their internals. Aside from more mundane qualitative improvements, it's likely to serve as an ironic reminder of what it's like to have your technology copied out from under you.

    News and rumours
    Helghan
    As with last quarter, June 3050 saw the arrival rates of refugees to the Periphery increase slightly; well over 1 million additional people arriving in ORDI systems compared to the same time three months ago. Handled by a well-funded ORDIHCR, these refugees joined those already waiting for entry into one of the alliance's five member-states; food, clothing, housing, and more awaiting them in specifically prepared refugee camps.

    Predicted Refugee Acceptance Breakdown For 3050 (+-5%)
    Helghan Republic:     26,100,000
    Aurigan Coalition: 2,050,000
    Capellan Confederation: 11,800,000
    Magistracy of Canopus: 5,200,000
    Taurian Concordat: 3,400,000

    To the rather pleasant surprise of the Helghan government and its military police alike, the year's second quarter saw a small but substantial number of Clan POWs agree to help Canopus' geneticists with their inquiries; biological samples flowing from Cassilda's POW camps in remarkable quantities within weeks of their arrival. Stored in specially made transport canisters and shipped back to Luxen for study with top-of-the-line medical equipment, analysis of the blood and tissue samples carried out over the quarter has already prompted a buzz of excitement from Canopus' medical establishment. Keeping their cards close to their chest, reports shared by Canopus nonetheless state that the genomes of those warriors willing to cooperate show signs of extensive genetic modification compared to those of an ordinary human being. While the nature and number of these modifications have yet to be determined—and will no doubt require a time-consuming sequencing of the Warrior caste's genome and a comparison with that of Inner Sphere humans—experts in the field of genetics have grown more and more excited about the topic as the days passed.


    Aurigan Coalition
    As with past quarters, Q2 3050 saw the Aurgigan navy welcome nine more Halcon class Destroyers into its ranks, the additional destroyers raising the Coalition's total warship count to thirty-four. A substantial force for any nation, the nation's contingent of warships also represents a major investment of time, money, and industry, so much so that the Coalition has reportedly ceased construction on further warships. In place of purely military vessels, the Arano government has declared that it will instead turn its slipways towards the construction of civilian and dual-purpose designs, the first such design presented to the Helghan Republic and its allies being a long-range exploration vessel inspired by the Markham's Marauder's Argo-class dropship.

    Named after the ancient exploration craft used by Polynesian explorers during Terra's pre-spaceflight history, the Wa'a Kaulua class is a purpose-built long-range exploration vessel intended to expand the bounds of human knowledge by hundreds if not thousands of light-years. Massing 200,000 tons, equipped with a compact KF drive, and bearing numerous onboard manufacturing and maintenance facilities, the Wa'a Kaulua class takes advantage of every ancient and modern technology in the Aurigan Coalition's arsenal to deliver a vessel able to venture deep into the galaxy. Boasting enough supplies and life support capacity to support its crew for two years before tapping into its cavernous cargo bays, the Wa'a Kaulua class also comes equipped with four docking collars, expansive vehicle and mech bays, and multiple small craft bays.

    Code: 
    [code]
Class/Model/Name:    Wa'a Kaulua 
Mass:                200000 tons

Equipment                                                 Mass
Engine:    Fusion Engine    2                             4000
Safe Thrust:    2    
Maximum Thrust:    3    
Structural Integrity:    60                               12000
Total Heat Sinks:    264 Double [528]                     0
Bridge, Controls, Radar, Computer & Attitude Thrusters    500
Food & Water (730 days supply)                            8439
Spare Parts (5 percent)                                   10000
Fuel & Fuel Pumps (50000 Points)                          10200
Jump Sail (3 Integrity)                                   40
Kearny-Fuchida Hyperdrive Compact (6 Integrity)           90500
Armor:    Standard (40 total armor pts)                   240

    Capital Scale Armor    
Front              10    
Fore-Left/Right    6/6    
Aft-Left/Right     6/6    
Aft                6    

Bays and Cargo:         
  Bay 1:    12 Small Craft Bay with 2 doors               2400
  Bay 2:    Unpressurized Repair Facilitiy with 1 doors   1250
  Bay 3:    Factory Unit with 1 doors                     10000
  Bay 4:    Ore Processing Unit with 1 doors              1000
  Bay 5:    2 MASH Equipment with 1 doors                 4.5
  Bay 6:    20 Heavy Vehicle (0-100t) Bay with 1 doors    2000
  Bay 7:    10 IndustriMech Bay with 1 doors              1500
  Bay 8:    Cargo Bay (Standard) with 1 doors             20443.5

Dropship Capacity:    4                                   4000

Life Boats:    56    0
Crew:        
66      Crew (304 minimum)                                462
19      Officers (61 minimum)                             190
220      Bay Personnel                                    0
21      Specialists (10 minimum)                          147
6      Gunners (1 minimum)                                42


    Weapons & Equipment    Loc     SRV     MRV     LRV     ERV     Heat    Mass
4    H-Medium Laser        Nose    2(20)   2(20)   2(20)   0(0)    12      4
4    Laser AMS             Nose    0(0)    0(0)    0(0)    0(0)    28      6
1    Hi-Res Imager         Nose    0(0)    0(0)    0(0)    0(0)    0       2.5
1    Infrared Imager       Nose    0(0)    0(0)    0(0)    0(0)    0       5
1    Hyperspectral Imager  Nose    0(0)    0(0)    0(0)    0(0)    0       7.5
1    Look-Down Radar       Nose    0(0)    0(0)    0(0)    0(0)    0       5
4    H-Medium Laser        FL/R    2(20)   2(20)   2(20)   0(0)    24      8
4    Laser AMS             FL/R    0(0)    0(0)    0(0)    0(0)    56      12
4    H-Medium Laser        L/RBS   2(20)   2(20)   2(20)   0(0)    24      8
4    Laser AMS             L/RBS   0(0)    0(0)    0(0)    0(0)    56      12
4    H-Medium Laser        AL/R    2(20)   2(20)   2(20)   0(0)    24      8
4    Laser AMS             AL/R    0(0)    0(0)    0(0)    0(0)    56      12
4    H-Medium Laser        Aft     2(20)   2(20)   2(20)   0(0)    12      4
4    Laser AMS             Aft     0(0)    0(0)    0(0)    0(0)    28      6
1    Comm.Equipment        Body    0(0)    0(0)    0(0)    0(0)    0       100
1    Mobile HPG            Body    0(0)    0(0)    0(0)    0(0)    40      50
                                
    TOTALS:                        10      10      10      0       360     250
    [/code]


    Capellan Confederation
    Shocking no one, Q2 3050 saw the Capellan navy double in size thanks to the launch of ten Carson II class frigates, the Capellan Warships immediately undergoing trial cruises up and down the length of the Inner Sphere nation in preparation for use against the Clans. Formed into ten squadrons of two mutually supporting vessels each, the rapidly expanding Capellan Navy is reportedly training officers and crew as quickly as it can in preparation for the launch of additional 500-kiloton and 1-megaton hulls; the Confederation intent on making the former the anvil of their fleet while the latter serves as the hammer. In support of this goal, the Capellans have also ceased work on 500,000-ton capacity slipways in favour of more 1,000,000-ton orbital slipways, two such slipways planned to open by the end of the year and another two in 3051.


    In something of a surprise to its allies in the Outer Rim Defence Initiative, early June saw the Capellan Confederation unveil a new unit of cybernetically enhanced soldiers to its fellow alliance members, the battalion-strong force related to and subordinated under the Confederation's infamous Death Commandos. Well aware of the Republic's successes against the Federated Suns with its own Cyborgs, it came as no surprise when said unveiling revealed that most of the Confederation's cyborgs bore relatively low-key implants and augmentations; the seeming purpose of the unit to infiltrate hostile nations and prove... difficult. On par with the Helghan Republic and Magistracy of Canopus' cyborg units in terms of individual capabilities, though not in overall size or maturity, the Capellan force has already made impressive showings in training against non-cyborg OpFor, and many expect to see it deployed to the Rasalhaugian front shortly.


    Magistracy of Canopus
    In similar news to the Aurigan Coalition and the Capellan Confederation, late June saw the launch of three Canopus class frigates by Magistracy shipyards, the trio of vessels bringing the total number of warships in the Canopian fleet to fifteen. Home to the second-smallest navy in the Outer Rim Defence Initiative, the Canopians appear happy enough with their production rate; reports sourced from news services and passive monitoring suggest no change in their rate of shipbuilding or shipbuilding capacity.


    Taurian Concordat
    Shocking no one, the same period saw the Taurian Concordat launch a number of vessels—a total of two Vanguard-class Destroyers and six Auroch-class Frigates slipping free of their moorings in mid-June. Immediately joining their sibling craft in shakedown cruises and anti-piracy patrols, the eight vessels represent a small but potent increase in the lethality of the Taurian navy and will no doubt serve with the same distinction as those that have come before them. In the same period, the Taurian Concordat not only announced the completion of upgrades to three of its five 200,000-ton capacity slipways, the shipbuilding facilities improved and expanded such that they can now handle work on larger and much heavier Frigates, but also completed work on three new 500-kt slipways, the total number of 500-kt slipways in the Concordat at an impressive 12 by June's end.


    However, much to the growing concern of figures within the Helghan Republic, despite the Calderon government trumpeting its naval successes throughout its territory, some Taurian citizens have begun to critique the sheer scale of the expenditure involved—planetary and warpcomm networks abuzz with estimated construction and maintenance costs. Though much of this critique has remained isolated to the recently absorbed territories of the former Federated Suns—and understandably so, given the as-yet-unresolved issues of rights and services in the region—each passing day has seen criticism grow more and more strident and spread further and further, already some of the more fringe commentators in the Concordat's heartland raising the matter on their platforms. How this critique will impact Taurian shipbuilding efforts remains to be seen, but Helghan analysts have warned their superiors to monitor the situation closely.


    United Rimward Collective
    Much to the surprise of the Republic's ruling government, early July saw Neo-Jacobinist groups within the URC reach out to the Outer Rim Defence Initiative to inform the alliance that they had recently captured several spies attempting to infiltrate their ranks and ask if the ORDI wanted to take charge of them. According to the message sent by the Neo-Jacobinists, they initially believed the spies belonged to rival groups within the URC before eventually concluding they were spies from an as-yet-undetermined Inner Sphere state due to several quirks noticed over long-term observation after their capture that suggested an out-of-region origin. Ordinarily, something the Republic would be overjoyed to hear, doubly so since the Jacobinists are offering to hand the spies over to the ORDI, the matter has been complicated by accompanying images which have revealed the spies to be the same ones the Republic failed to insert into the region over the quarter.

    While any embarrassment suffered by the Republic in the eyes of its allies is likely to be both temporary and harmless should it be forced to inform them of the spies' true origins, many within the Republic's intelligence community have been baffled by the Jacobinists actions; some suggesting that they truly don't know who the spies belong to, and other suggesting they know exactly who was attempting to spy on them and are trying to make a point by informing the ORDI as a whole that they captured them. Regardless of what exactly the Neo-Jacobinists hoped to achieve by informing the ORDI about the spies' existence and capture, the Republic's government has a decision to make over the coming days.

    Effect
    • Choice next turn

    Federation of Autonomous Systems
    To the great satisfaction of the nation's citizens, Q2 3050 saw the Federation of Autonomous Systems succeed in capturing those former officials involved in the earlier corruption scandal; both the money they stole and the officials themselves recovered in a sweeping series of sting operations. Made possible through ComStar's cooperation—itself bought by Helghan's deal with the quasi-religious organisation—the sting operations saw the criminals arrive at ComStar HPG compounds to clear up supposed issues with their accounts, only to find themselves detained by ComStar guards and handed over to FAS police. Already on their way to the Federation, the criminals will be prosecuted to the fullest extent of the law upon their arrival in August and, hopefully, found guilty of many criminal offences.


    ComStar
    To the quiet surprise of Helghan's government, the April-June period saw a series of reports indicating the continued withdrawal of security forces from ComStar's HPG compounds in the Inner Sphere, a hundred separate tributaries gradually forming a gargantuan river bounded for Terra. No doubt intending to defend humanity's homeworld and its surrounding systems from the Clans should they break through Coreward states, the recalled troops will almost certainly undergo an intense training program upon their arrival. While the initial reactions of government ministers to the news were quite positive, subsequent comments by Republic military leaders and reports provided by Helghan analysts quickly dimmed hopes that this force might prove meaningful in the Clan Invasion, both groups agreeing that no training program would be enough to forge ComStar's security personnel into a capable fighting force in the time available unless the organisation has been hiding a military program this entire time.


    Clan Invasion (Varied)
    In recent news from the Lyran Commonwealth, it appears that reports of injuries and deaths among the Kell Hands were not exaggerated; Morgan Kell—famed MechWarrior, cofounder of the Kell Hounds, and brother to Patrick Kell—and many other mercenaries were killed in an engagement with Clan Coyote last quarter. With details having finally made their way through the galaxy via rumour mills and ComStar's News Service, the story of how Morgan Kell brought an entire Clan assault force to a standstill via cunning use of Zelbringen has become almost mythical in the minds of MechFans the galaxy over. Although the exact details of the story change with each retelling, the version compiled by Helghan analysts describes how Morgan Kell, isolated and alone after ordering his lance to regroup with forces under his brother's command, fought a desperate rearguard action against a Clan counter-attack barreling down on the Kell Hounds' staging grounds; the man challenging the Clanners to a series of one-on-one duels for control of the narrow passage leading to the staging area.

    Forced by their rules and culture to humour the man, the Coyotes bid among themselves for the honour of duelling him, with the first one stepping forward within moments. Minutes later, as the slain MechWarrior's mech toppled to the ground, Morgan Kell repeated his challenge, and another MechWarrior stepped forward. Again and again, the pattern repeated itself as—using everything from missiles to lasers to bare fists—Morgan Kell slew warrior after warrior until after a star and a half worth of Coyotes lay dead or dying at his feet. Barely able to move his Archer, its armour shattered and myomer internals smouldering, Morgan Kell supposedly made one last challenge to the Coyote force and was, in turn, slain with a single shot to the cockpit.


    Federated Suns
    Coming as something of a surprise to those in the Republic intelligence community involved in the matter, attempts to tie the Federated Suns to the Neo-Jacobinists have drawn a collective blank; operatives and catspaws within the Federated Suns' intelligence agencies proving unable to find any hard evidence suggesting that there are links between the two groups. An extremely curious outcome considering recent reports from analysts studying the Neo-Jacobinists, explanations for the lack of evidence run the gamut of said interactions being run off the books to the entire body of "evidence" being tainted by expectation bias. However, almost as if only to complicate matters, the same spies responsible for failing to uncover ties between the Federated Suns and the Neo-Jacobinists have also reported that the Security Office of the First Prince has had its budget, powers, and responsibilities expanded dramatically in the time since the Outback intervention; several secretive measures passed to transform it into a small but potent intelligence agency answerable only to the First Prince himself.


    Somewhat less comforting, 3050's second quarter saw the Federated Suns' navy continue to expand, four more Reynard-Class and two more Chevalier-class vessels joining the ranks of that once decrepit fleet. Bringing the total number of warships in the Federated Suns to eighteen, the half-dozen new vessels represent a sizable increase in capability and lethality for the nation, rendering it the largest and most powerful navy among the Four Great Houses. Worse still, the same period also saw the Federated Suns complete work on shipyards on the planets Markesan and New Avalon, the new 500,000-ton capacity slipways doubling the Suns' ability to construct frigates. Though unable to compete with any individual ORDI nation, those who study such things have suggested that the Federated Suns' dedication to naval construction speaks to a deep-seated desire to avoid a repeat of the Outback Intervention—a more capable fleet armed with powerful weapons something that would greatly diminish the ORDI's advantages in space and on the ground.


    Free Worlds League
    Late to get into the game but no less eager to perform, June 3050 saw Free Worlds League workers double the number of 500,000-ton capacity slipways in the League, four new slipways joining the four already present within the nation's industrial core. No doubt terrified of the Outer Rim Defence Initiative's naval might, understandably so considering just how potent it is, Republic analysts believe that the League will pursue an aggressive shipbuilding program in the coming years, messages from Helghan spies detailing frantic activity occurring within all eight slipways. While such estimates are naturally hazy, analysis of League industrial capabilities combined with historical reports suggest that the first batch of warships from League shipyards will likely launch in September of this year.

    Lyran Commonwealth
    In similar news, ORDI spies operating within the Lyran Commonwealth have reported the completion of another four 500,000-ton slipways by Lyran workers, their frantic labour rewarded with generous bonuses and, apparently, more work. Driven to such heights of effort by the rapidly approaching Clans and their potent warship fleets, the same period saw four more Thor-class frigates join the Lyran navy, their hasty shakedown cruises bookended by immediate deployment to the ongoing counter-attack. Though far from being able to contest the Clans' fleets, the production of warships appears far from stopping and Archon Steiner is reportedly considering another round of wartime taxes to pay for additional shipyards, slipways, and ships.


    With the Lyran counter-attack already well underway as March turned to April, the year's second quarter saw the LCAF's momentum grow as Lyran generals moved additional troops into the mix, thousands of soldiers joining their comrades on the frontline and all but throwing themselves at their enemy. Continuing the strikes against Clans Coyote and Diamond Shark, Lyran troops drawn from deep Lyran territories and mercenaries hired on the open market landed on planets across a hundred-lightyear-wide front as the Commonwealth sought to push back the Clan invaders away from its industrial heartland. Kept fueled, fed, and supplied by an ever growing stream of supply vessels, the titanic force assembled by the Lyran state crashed down upon the Clan defenders of Yeguas, Esteros, Bountiful Harvest, New Exford, Deia, Mkuranga, and Zhongshan like a tsunami, Stars of omnimechs and elementals pulled down and destroyed by a force once considered beneath them.

    A forceful blow against the Coyotes and Sharks, June's end saw all nine worlds retaken by the LCAF and images of Lyran flags raised on smouldering Clan mechs to the joy of a populace hungry for good news. However, despite the rosy images presented by Lyran propaganda, reports from ORDI spies within the Lyran government paint a darker, albeit hazier, image of high casualties and bitter fighting; urban warfare on Deia and major ASF battles on and above New Exford costing many lives and robbing the counter-attack's momentum when the Lyrans could ill afford it. Nonetheless, despite the casualties suffered and the gradual loss of momentum, early July saw the morale of the Lyran people reach an all-time high thanks to the spate of victories delivered by the LCAF and the heroic tales of warriors like Morgan Kell, recruitment centres throughout the Commonwealth reporting lines around the block as patriotic citizens attempt to do their part.


    Draconis Combine
    As hoped by many but assumed by none, April 3050 saw the Draconis Combine finally launch a counter-attack of its own against the invading Clans; troops pulled from across the state assembled into a mighty war host and thrust at the Jade Falcons and Nova Cats like a spear to the gut. Guarded by the Republic's Nocti and transported by JumpShips temporarily seized from local traders, the three-month period saw the DCMS rush at the Clanners in a furious attempt to push them back from Luthien's doorstep. Urged onto new and greater heights of martial achievement by speeches from the Coordinator himself—historically, a rarity from the famous reserved institution—Combine troops fought against the Clanners with an almost religious zeal, the technological gap between the two forces bridged thanks to a combination of international aid and dogged determination.

    Again and again, system after system fell to the Combine's push, with Port Arthur, Asgard, Cyrenaica, Kilmarnock, Irece, Juazeiro, and Teniente retaken one after another as superior numbers and all but unbreakable morale saw Clan formations smashed flat. A bitterly fought contest, reporting from ComStar's news services combined with analysis of post-battle imagery by ORDI personnel suggests that these victories were not easy for the DCMS, with casualties numbers assumed to be in the double-digit thousands. Whether the casualty rates sustained in exchange for the pushback of the Falcons and Nova Cats will prove a poison chalice for the Combine remains to be seen, though many across the galaxy hope not.

    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship )

    Support Modifiers
    Navy    :
    • +2 (Make-Do Yardships)
    • +3 (Tsitsang Fleet Anchorage)
    • +5 (Decreased Distance)
    • +2 (Parthian-class Mobile Shipyard)
    • +2 (ComStar Command Circuit Route)
    • -2 (ORDI Donation)
    Ground Support Capacity:
    • +1 (Tsitsang Ground Facilities)
    • +0.75 (ComStar Command Circuit Route)
    • +0.25 (Fort Loudon)
    • +0.50 (Decreased Distance)
    • +1 (Forge Pack)
    • +0.50 (Forge Pack)
    • +0.25 (Forge Pack)
    • -1 (ORDI Donation)
    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 18/18 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.95/4.0 [Base: 0.75] (use the transport size value)
      Navy (18/18 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 1 Pilum Battlecruiser (2 Capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 42 Commissar-B Pocket Warships (0 capacity)
      Ground (3.95/4.0 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight) [85% health]
      • Fourth Division, First Army (0.5 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • 1 regular BattleMech regiment (0.1 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Beats Walking)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 4 Carson II-class Frigate (4 Capacity)
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 4 Auroch-class Frigate (4 Capacity)
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships



    Q2 Casualty Estimates
    CasualtiesTotalKilledInjured
    Helghan Republic Armed Forces924231693
    Aurigan Coalition Military444111333
    Taurian Defence Force38496288
    Magistracy Armed Forces35689267
    Capellan Confederation640160480
    Clan Invaders (Est.)20,00+500+1,500+
    Civilians (Est.)14,000+3,50010,500+


    Casualties To Date
    CasualtiesTotalKilledInjuredMissing
    Helghan Republic Armed Forces5,3571,4403,344573
    Aurigan Coalition Military2,5646311,87162
    Taurian Defence Force3,74311082,492143
    Magistracy Armed Forces3,65510042,493158
    Capellan Confederation4,6611,3093,244108
    Clan Invaders (Est.)11,1004,600+6,500+--
    Civilians (Est.)115,60036,400+79,200+--


    Map of the Inner Sphere (End of June, 3050)

    Link to image is here

    Updated Info Posts
    Helghan Republic Order of Battle

    The Lords of Ruin -- Battletech/Killzone Crossover

    Helghast Order of Battle: Doctrine: Super-mobile blitzkrieg doctrine based around deploying divisions via ship-based dropships and cruisers. Navy...
    forums.sufficientvelocity.com
     
  • View discussion
    • The Clan Invasion -- July-September 3050 Actions
  • View content
    • The Pyrrhus Game
    In the wake of the rather embarrassing revelation that the Helghan spies sent to infiltrate the Neo-Jacobins were not only captured but also unknowingly offered to the ORDI as a whole by said Jacobins, the Helghan government found itself confronted with a list of unenviable options for what to do next and how much to say to its allies. Unsure as to whether the offer to hand over the supposed Inner Sphere spies to the ORDI was made in good faith or not—and leary of burning bridges—the political decision-makers of the Gemini government naturally proposed three mutually exclusive courses of action for the Republic to pursue, the thought of unanimity seemingly never crossing their minds. Ranging from the ultra-cynical to politically expensive, the options presented were argued over endlessly by their proponents and opponents, and none left wholly satisfied by any option.

    Unsurprisingly, from among the more cynical—or realistic, if you ask them—operators of the Gemini government came the call to disavow the agents and allow fate to take them as it may. Considered deeply cynical by their opponents, political or otherwise, proponents of the move have argued that not only is such a thing a risk understood and accepted by all Republic's spies, but that attempting to bring them into the Republic's sole custody would put a target on their back, require the Republic to spend influence better used elsewhere, and all but admit that they belong to the Republic.

    Their political counterparts, meanwhile, have suggested that the Republic should fight hard to have its spies delivered into its arms, even if it means admitting to its allies—and only its allies—the spies' true origins as Helghan operatives. Moreover, members of the faction have pointed to the Republic's successful rescue of spies captured during the Outback intervention as a precedent for fighting for Helghan spies, claiming that abandoning these would be a backward slide. Arguing that the morale benefit and buttressing of the Republic's ideals is well worth the influence used to convince all involved that the Republic should have sole custody of the spies and the potential embarrassment of admitting to their origin, this faction has developed a small but notable following.

    Finally, as a compromise position, a small but influential group of policymakers has proposed that the Republic split the difference between the two groups. Pointing to the valid concerns of the other factions, this group has argued that the Republic should use what pull it has among the ORDI nations to have the Republic assigned the task of imprisoning and interrogating the agents but refrain from admitting to its allies as to their true origins and be willing to let them go. Though disliked by many for its attempt to both have a cake and eat it and criticised for its idealism and possible impact on morale within the Republic's intelligence sector, few can deny that it tries to split the difference between the two options.

    Which Options Does The Republic Go For?
    [] Cut Them Loose
    [] Bring Them Back
    [] The Third Way
    [] Write-in

    The Helghan Way
    With the unwelcome discovery of substantial flaws in the manufacturing process used to create several vital parts for the ORDI's newly developed battle armour, July 3050 saw the Helghan Republic caught in a bind of its own accidental making. Suffering higher-than-expected casualty rates at the front due to the restrictive nature of the warfare there, as well as the advanced technology and incredible skill of Clan pilots, interest in providing Operation Santiago with something equivalent to Clan Fleas was at an all-time high; few were willing to see ORDI soldiers dying preventable deaths if they could help it. As a result, the Republic found itself under immense pressure to deliver functional and reliable battle armour quickly, but the high rate of component failures suffered during testing made such a goal impossible to achieve. Initially riven with arguments as various factions within the government sought to push their own particular agendas, Darwinian selection combined with natural compromises swiftly narrowed the field down to only a handful of options.

    Pushed by the Republic's more manufacturing-oriented politicians and backed by those fearful of Clan technology, one of the more popular viewpoints held that the build quality delivered by the production lines was so unacceptable that the Republic's only choice was to analyse where the processes went wrong and rebuild them to eliminate the flaws. Acknowledging that such an act would no doubt cost the Republic many millions of Marks and delay the delivery of battle armour to the front by at least a quarter, proponents of this view nonetheless consider the trade-off worth it, with both the lives of ORDI troops and the reputation of the Republic at stake.

    Meanwhile, attempting to split the difference, a number of politicians and military figures have united to propose introducing a set of heightened quality control standards specifically for battle armour components. Ranging from additional random checks to tighter build tolerances, putting the components fabricated by battle armour factories through these more extreme quality checks will arguably ensure that only acceptable parts reach the front line... at the risk of substantially fewer parts reaching the front line. A natural—if painful—trade-off, it is an argument whose critics find hard to counter outside of its lowered output.

    Finally, and perhaps the least popular argument espoused during the discussion but one with a certain terrible logic, some pushed for the Republic to accept the heightened failure rate considering the situation on the frontline. Citing the high casualty rates sustained against Clan forces as well as the testing reports which described components as lasting for some time before failure, proponents of this view have suggested that the standards applied to the failing components are too high and that the Republic cannot afford to either delay the introduction of battle armour or limit how much arrives at the front. Acknowledging, if rather grimly, that the decision to accept the failure rates as a cost of doing business with near wartime production will lead to some tragic deaths, backers of the idea have kept their support quiet but made it clear to influential figures in the Gemini government all the same.

    Which Does The Republic Choose?
    [] Analyse and rebuild the production line and eat the build cost (this will auto-lock in the construction action this turn)
    [] Increase testing and accept the lower output
    [] Accept the heightened failure rate


    Actions
    You have 6 out of 10 Action Points to spend. -1AP from Tikonov Command Circuit rental. -1AP from Free Worlds League Command Circuit rental. -1AP from Anti-Clan AgitProp effort. -1AP from Lothan Factory Complex Construction.

    This list of available actions is by no means exhaustive, so feel free to suggest more actions or variations on the actions listed below.

    Federated Suns:
    [] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Stage diplomatic incident [Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/12 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Continue NAIS Infiltration [Medium-Hard]: Continuing prior efforts to infiltrate the New Avalon Institute of Science is vital if we want access to their latest designs and most secure production sites.
    [] Steal research [Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Infiltrate Davion Palace [Hard]: By infiltrating the Davion palace, we can gain access to its most vital secrets and most important people.
    [] Write-in:

    Lyran Commonwealth:
    [] Expand Lyran intelligence network: Having placed a large number of agents within the lower levels of Lyran society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Medium]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Steal research [Very Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Very Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]

    Free Worlds League:
    [] Expand League intelligence network: Having placed a large number of agents within the lower levels of League society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Hard]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Extremely Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in (Convince me you've got something good)

    Draconis Combine:
    [] Arms Sales: With the Combine now at war, they may be willing to purchase items up to and including formerly LosTech ammunition from the Republic. Given the distances involved, such shipments will be very difficult until efforts are made to improve the backend logistics. [-5 influence]
    [] Tech for Tech: By offering the Combine information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.
    [] Expand Combine intelligence network: Having placed a number of agents throughout Draconis society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Impossible]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-15,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in

    Trinity League:
    Unrest in the Former Trinity League: Low
    League Self-Governance: None
    [] Fate of the Trinity League (Write-In): With the former rulers of the Trinity League either deposed or enjoying a relaxing vacation with their newfound wealth on the planet of their choosing, the question remains "What does the Republic wish to do with the systems of the former Trinity League?" [Note: This will unlock further options depending on what you do]

    Capellan Confederation
    [] Tech for Tech: By offering the Confederation information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.

    ORDI Actions
    [] Write-in

    Helghan Republic
    [X] Establish a continuing effort to provide propaganda relating to the Clan war effort [Ongoing]
    [] Construct a military defence station over [LOCATION]
    Locations available:
    • Cassilda
    [Can be taken multiple times in a turn]
    [] Upgrade a military defence station at [LOCATION]
    • Available stations:
    • Caliban (Medium → Large)
    • Charybdis (Medium → Large)
    • Highwater (Medium → Large)
    • Mir (Medium → Large)
    • Tiverton (Medium → Large)
    • Contrilla (Small → Medium)
    • Detroit (Small → Medium)
    • Mantharaka (Small → Medium)
    • New Oslo (Small → Medium)
    • Rogue (Small → Medium)
    • Spencer (Small → Medium)
    [Can be taken multiple times in a turn, but you can only upgrade a single station once per turn]
    [] Construct a Petrusite synthesis plant on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Helghan
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]
    [] Construct a secondary fleet anchorage on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]

    Military
    [] Raise an Army: Task your military with forming an additional army. [Progress: 0/2] [Can be taken multiple times in a turn so long as there is recruitable population remaining]
    [] Construct two Hasta-class cruiser Squadrons: Task your shipyards with constructing three Hasta Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIIC-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIIC Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIID-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIID Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct one Noctis-class cruiser Squadrons: Task your shipyards with constructing six Noctis Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Damascus-Class Carrier Squadron: Task your shipyards with constructing a squadron of Damascus-Class Carriers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Toxotai-class Guided Missile Cruiser Squadron: Task your shipyards with constructing a squadron of Toxotai Guided Missile Cruisers. [Progress: 0/3] [Can be taken up to four times in a turn]
    [] Construct 4 Guardsman-class Pocket Warships: Task your shipyards with constructing 4 Guardsman-class pocket warships. [Can be taken multiple times a turn]
    [] Construct a Pilum-class Battlecruiser squadron: Task the Detroit shipyards with building a squadron of three Pilum-class battlecruisers. [Progress: 0/6] [Cannot construct other 1m+ ton designs until completed]
    [] Hecatoncheires-class Escort Carrier Squadron: Task your shipyards with constructing a squadron of Hecatoncheires-class Escort Carriers. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a MAWLR-II pack: Task your heavy industry with constructing a pack of three MAWLR-IIs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a SAHLR pack: Task your heavy industry with constructing a pack of three SAHLRs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Hydra pack: Task your heavy industry with constructing a pack of three Hydras. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Dragon pack: Task your heavy industry with constructing a pack of three Dragons. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Pyrrhus pack: Task your heavy industry with constructing a pack of three Pyrrhuses. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct 2 Battlemech Battalions: Task Fisher & Zulim Taw with constructing 2 battalions worth of mechs.

    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship )

    Support Modifiers
    Navy    :
    • +2 (Make-Do Yardships)
    • +3 (Tsitsang Fleet Anchorage)
    • +5 (Decreased Distance)
    • +2 (Parthian-class Mobile Shipyard)
    • +2 (ComStar Command Circuit Route)
    • -2 (ORDI Donation)
    Ground Support Capacity:
    • +1 (Tsitsang Ground Facilities)
    • +0.75 (ComStar Command Circuit Route)
    • +0.25 (Fort Loudon)
    • +0.50 (Decreased Distance)
    • +1 (Forge Pack)
    • +0.50 (Forge Pack)
    • +0.25 (Forge Pack)
    • -1 (ORDI Donation)
    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 18/18 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.95/4.0 [Base: 0.75] (use the transport size value)
      Navy (18/18 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 1 Pilum Battlecruiser (2 Capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 42 Commissar-B Pocket Warships (0 capacity)
      Ground (3.95/4.0 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight) [85% health]
      • Fourth Division, First Army (0.5 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • 1 regular BattleMech regiment (0.1 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Beats Walking)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 4 Carson II-class Frigate (4 Capacity)
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 4 Auroch-class Frigate (4 Capacity)
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships


    [] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessel's to Clan-held regions will improve the ORDI's ability to gather information substantially.
    [] Prioritise Naval Supplies: By prioritising the shipment of naval supplies over those for ground troops, we can further improve our ability to deploy naval forces to the Outback. [+1 Naval Support Capacity, -0.125 Ground Support Capacity]
    [] Prioritise Ground Supplies: By prioritising the shipment of supplies for ground troops over those of the navy, we can further improve our ability to deploy ground forces to the Outback. [+0.25 Ground Support Capacity, -0.5 Naval Support Capacity]
    [X] Lothan Factory Complex Construction: As expensive as it will be, constructing a factory complex on Lothan will provide ORDI forces with an additional source of spare parts. [Progress: 0/10] [Locked Until Completed] [+1 AP from Capellan Confederation]
    [] Swap Ground Supplies for construction materials (amount to trade): By replacing a percentage of the expendables bound for ground troops with construction materials, we can bring forward the completion date of the factory quite substantially. [Every 0.25 points of Ground Supplies traded gives a +5% modifier to the base value of Helghan AP used on the factory] [You can gain a max bonus of 25%. This bonus stacks with the naval version but does not apply to the one-time boosts.]
    [] Swap Naval Supplies for construction materials (amount to trade): By replacing a percentage of the expendables bound for naval forces with construction materials, we can bring forward the completion date of the factory quite substantially. [Every point of Naval Supplies traded gives a +5% modifier to the value of Helghan AP used on the factory] [You can gain a max bonus of 25%. This bonus stacks with the ground version but does not apply to the one-time boosts.]
    [] Rush Supplies to the Front V1: Though we can only afford to do it once, we can push our transport vessels to the limit and move additional construction materials to the front at the risk of wrecking a few engines. [+1 AP progress on construction] [-1 Naval Supplies, -0.3 Ground Supplies for this turn] [Picking this option locks out V2 and V3]
    [] Rush Supplies to the Front V2: Though we can only afford to do it once, we can push our transport vessels to the limit and move additional construction materials to the front at the risk of wrecking a few engines. [+2 AP progress on construction] [-2 Naval Supplies, -0.6 Ground Supplies for this turn] [Picking this option locks out V1 and V3]
    [] Rush Supplies to the Front V3: Though we can only afford to do it once, we can push our transport vessels to the limit and move additional construction materials to the front at the risk of wrecking a few engines. [+3 AP progress on construction] [-3 Naval Supplies, -0.9 Ground Supplies for this turn] [Picking this option locks out V1 and V2]
    [] Operation Santiago Phase 7 Objectives (Failure to detail new objectives for Operation Santiago will have me pick ones based on prior discussion) [You can have a max of 300 words and 2 if statements in this action.]


    Military Requisition And Design
    You have 4 out of 4 Requisition Points to spend on upgrading Helghan's ground forces. These upgrades are given to all active armies at once, though the more armies you have the longer it'll take to roll out changes.

    Requisition

    Design
    [] Dropship Design: (tell me what you're trying to design)
    [] MAWLR Redesign: Order your design teams to redesign the MAWLR to make use of the latest technological advancements.
    [] Design write-in: Order your teams to design a solution to a capability gap. (tell me what you're trying to design)
     
    Last edited:
  • View discussion
    • The Clan Invasion -- July-September 3050 Results
  • View content
    • [X] Plan: Factory Recall
    https://forums.sufficientvelocity.com/threads/the-lords-of-ruin-battletech-killzone.52819/page-1089?post=31966899#post-31966899

    The Pyrrhus Game
    [X] Bring Them Back
    Presented to the ORDI as a fait accompli, the Neo-Jacobinists' declaration that they had captured spies originating from an as-yet-unknown Inner Sphere state had generated substantial buzz from Helghan's allies within minutes of its announcements. Eager to get their hands on the prisoners and heavily invested in determining if another nation was responsible for the region's recent chaotic goings-on, the Confederation, Concordat, and Magistracy all made clear that they were willing to fight for the honour of breaking the spies' security; carefully worded boasts flying thick and fast over intra-ORDI comms channels. Caught between a rock and a hard place by the possibly canny, possibly sincere actions of the Jacobins and alarmed at the thought of its agents mistakenly ending up in unfriendly—albeit allied—hands, Q3's first few days saw the Malkiewicz government decide to go to the mat for its captured spies; all reasonable measures approved for use, even the admission of their origin.

    Wading into the fray with a diplomatic shock and awe campaign, Helghan diplomats barraged their counterparts with a smorgasbord of arguments as to why the Republic should be the one to break the spies; everything from the nation's impressive penetration of the Federated Suns to its overriding interest in a stable buffer state thrown into the ring. Over wine and dinner and coffee and cakes, arguments as fierce as any battlefield raged as government priorities were translated into soft-sounding diplomatic niceties, the outcome of a dozen conversations swinging back and forth as each side sought to triumph over the other. Armed with a slew of apparent reasons for wanting the agents for itself bolstered by a far superior truth, Helghan found its allies' resolve slowly worn away until, by mid-July, only the Taurian Concordat held firm. Finding the Taurians more than willing to fight tooth and nail for the spies—who, they quickly made clear, they suspected belonged to the Federated Suns—and with time steadily running out, Helghan diplomats reluctantly went for the nuclear option.

    In a one-on-one meeting between the senior diplomat Ella Vlahović and her counterpart from the Concordat, the Republic privately admitted to the spies' origins and purpose for being in the United Rimward Collective, the half-hour it took for the Concordat's envoy to relay the meeting and receive orders from the Blue Palace reportedly the longest and most awkward Vlahović's career. Following the highly embarrassing conversation, the Taurians quietly agreed to retract their claim on the operatives and made good on their word mere days later. Falling into Republic hands by default, the spies quickly vanished into a finely crafted intelligence black hole—those not in the know assured that the Republic would do whatever it took to find out where the spies hailed from.

    Effect
    • Spies collected by the Republic and vanished.
    • Only had to admit their true origins to the Taurian Concordat.

    The Helghan Way
    [X] Analyze and rebuild the production line and eat the build cost (this will auto-lock in the construction action this turn)
    [See Subsequent Action]

    Temp
    • Look, there's no actual point to me writing anything for this one :V
    [X] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalize on the effort and expand the Republic's reach.
    Eager to capitalise on last quarter's success reconnecting with agents once thought lost and desperate for a glimpse at the inner workings of the Federated Suns' highest levels of government, early July saw Helghan intelligence services start pursuing an aggressive infiltration policy against the Suns. Within weeks of the decision, well-established Republic operatives throughout the Inner Sphere nation found new messages awaiting them in digital dead drops, the curt notes ordering them to gain access to the First Prince's network of palaces however they could. The cream of the crop of the Republic's intelligence community and, by now, extremely well versed in the ins and outs of FedSuns culture, dozens of operatives threw themselves into the task of being recruited by the First Prince's extensive network of palace personnel, mid-August seeing a handful of them succeed after numerous false starts and near paranoiac background checks.

    Present in only the lowest roles employed by the First Prince's various palaces and lacking much in the way of security credentials, the sheer presence of these agents in Morgan Davion's palaces nonetheless granted the Republic a hitherto unknown level of access to the daily goings on of the Palaces' inhabitants and their unguarded conversations. According to messages that have wound their way back to Helghan in fits and starts, overheard conversations and glimpses of top-secret documents have indicated that the primary concern of the First Prince and his inner circle has, for the past few months, been the rapid and continued rise of far-right politics throughout the Federated Suns. Though only able to hear second or third-hand rumours on the matter, the First Prince and his allies at court are reportedly greatly worried about the speed at which the various right-wing groups have grown, the most common concern being that they might force a second confrontation with the ORDI before the AFFS is ready.

    Meanwhile, the second most common concern among those in the highest halls of power in the Federated Suns is, understandably, the Clan Invasion. Located on the opposite end of the Inner Sphere from the Clans and with the AFFS having yet to face them in battle, fear of the quasi-alien MechWarriors appears ever-present but muted throughout the palaces. While all involved in the overheard conversations agree that the Clans are a threat the Suns must prepare for, most discussions revolve around a planned expansion to the trade deals organised with the Lyran Commonwealth and the deployment of an AFFS expeditionary force to support the Lyrans, garner more Clan salvage, and develop a corp of troops experienced in Clan warfare. Meanwhile, discussions on the Draconis Combine range from hoping the Suns' historic rival continues to block the Clans' progress to, though surprisingly unpopular, hoping that it explodes such that the Suns can consume a large chunk of their shared border.

    Of perhaps the most interest to the Republic's government is the fact that few within the palaces appear interested in the events occurring in the United Rimward Collective. Though the strife between the Neo-Jacobins, Marxists, and Maoist-Gaullists has been noted in the palaces several times, the civil conflict appears relegated to the sidelines of most conversations, and many seem to hope that it becomes a sucking wound that drains the ORDI of material wealth and governmental support for interventionism. A surprising revelation by all accounts, the news that the political strife in the region has been received somewhat cooly by the Federated Suns has left some torn between wondering if the First Prince is keeping his actions secret from his government or if he even had a hand in it at all.

    Effect
    • Republic succeeds in planting several agents in the First Prince's network of palaces, though they have little access.
    • Republic learns a little of the nation's priorities

    [X] Fate of the Trinity League: With the former rulers of the Trinity League either deposed or enjoying a relaxing vacation with their newfound wealth on the planet of their choosing, the question remains "What does the Republic wish to do with the systems of the former Trinity League?"
    -[X] Start the process of organizing local governance to the degree that plebiscites can be held regarding bringing the former Trinity League worlds into the Helghan Republic. In terms of eventual bait to lure them in with, we can pledge to solve major issues and sell the benefits of our already extant development programs for our planets, such as the latest one we've introduced to bring places up to spec in both technological capability and industry, as well as various mega-projects and initiatives we've conducted to improve planetary conditions elsewhere.
    Surprising very few, early July saw a fraction of the Helghan Republic's attention again turn to the half-dozen worlds lying on its coreward border, the issue of what to do with its millions of inhabitants rising to the forefront of many minds. Once forged into a bandit kingdom dubbed the Trinity League by the Capellan deserters who had created it, the League had been an aggressive, if largely harmless, power in the region for several years; its rulers restraining their activities to the handful of independent systems that remained following the formation of the ORDI. Eventually destroyed by the Helghan Republic's Operation Telemachus—most of the leadership bought off, and the worst of the worst otherwise dealt with—the inhabitants of the short-lived state found themselves temporarily ruled over by Helghan peacekeepers and administrators. Fortunately for the Republic and former Trinity League alike, a combination of adroit decisions and good fortune ensured that months following the disbandment of the League passed smoothly; issues such as landgrabs by planetary nobility, food distribution disruptions, etc., dealt with swiftly and effectively: the chaos and death many feared at the start of the operation avoided entirely. Ever wary of being outcompeted by their allies thanks to their far larger populations and easy access to resources and unwilling to provide for tens of millions of people for the indeterminate length of time it'd take for each system to regain its footing, the Republic's government determined to square the circle and take a third route.

    Having already invested a great deal in the former Trinity League and with goodwill towards the Republic at an all-time high in all systems, the first weeks of July saw Gemini Malkiewicz's government decide to invite all six of the quasi-independent star systems to join the Republic as member-states. With the decision made and each system more or less self-governing—local governments already pieced together by the efforts of Helghan administrators—the Republic immediately began making its case to all who would listen. Inviting the respective leaders of the systems to take their time in considering whether to put the invitation to a referendum, Helghan simultaneously launched a media campaign unparalleled in the region's history: millions of Marks and hundreds of messaging specialists turned to the task of convincing the public that joining the Republic was in their interest.

    Carried over the airwaves of hundreds of cities, written on pamphlets handed out to tens of thousands, and talked about in the living rooms, workplaces, schools, and bars of countless millions, the Republic's message to the region played again and again. Speaking plainly and without restraint, the Republic's messengers told of bread for all and roses, too; promises made of food and drink and health and leisure and a host of other things that were rare at best in a backwater area of the galaxy. The Republic, it was intimated without a word of a lie, had everything for everyone.

    To no one's surprise, this campaign proved its worth almost immediately, with mid-August seeing an overwhelming majority receptive to its messages. Unable to refuse the mounting pressure and, frankly speaking, disinclined to do so anyway, planetary leaders gave in to the inevitable. Announcing their decision in September's final weeks, referendums on whether or not systems would accept the proffered invitation were declared by all six planetary governments, the earliest vote planned for November to ensure that every citizen could have their say.

    Effect
    • All six governments agree to host referendums to join the Republic.
    • Public support to join the Republic is high in all six planets, and analysts think it likely that the votes will likewise succeed.
    • Votes planned for Q4

    [X] Make inquiries to the Taurians about what they need most in their Outback reconstruction efforts, then promptly purchase and donate the equipment or materials. While additional Horus Mk IIs are, for example, something we'd be happy to provide at a tremendous discount or simply as a type of subsidy, the other information they provide us will likely inform on what form more large-scale aid from us will take, or if visible Helghan assistance would even be appreciated by the locals or just cause more problems.
    Having grown concerned over the increasing discontent in those former FedSun systems now claimed by the Taurian Concordat—discontent, it must be said, driven primarily by slow industrial development and the continued lack of supposedly guaranteed rights—early July saw the Helghan government reach out to its spinward comrades with a generous offer of assistance. Carefully worded so as not to offend the famously independent Taurians or be seen as diminishing the state's prodigious capabilities, the Republic dispatched a message to its longtime ally offering substantial discounts on all manner of industrial goods and machinery: Horus class mobile factories, construction automata, armoured spacesuits, and many other items heavily subsidised and offered at almost subterranean rates compared to the norm. Though ultimately only a fraction of the resources undoubtedly required to turn systems like Corodiz or vast clusters of stars such as the Pleiades into emblems of the Taurian Dream, these items represented the mere tip of the iceberg of aid the Republic was willing to offer; Edward Calderon's Protectorship invited to elucidate as much or as little as they wanted.

    Arriving at Taurus mere days into the month, it took a week for the Concordat to respond formally; the Republic's generous subsidies accepted almost without question, and a laundry list of goods and materials proffered in response. From subsidies for fibre optic cables to the outright delivery of common vaccines to those planets that needed them most, the aid requested by the Taurians ran the gamut of industries and types, the comms network between Helghan and Taurus set groaning under the weight of the Concordat's requests. Quickly determined to be only a fraction of what the Taurians' plans for the region called for, it became clear equally rapidly that it would be the work of a decade (or more) for the Republic to fulfil the Taurians' needs, the sheer scale of the problem so vast that not even the Republic's gargantuan industrial might could provide the high-tech materials in a lesser timeframe.

    Effect
    • The Taurians accept, but their need for high-tech materials is as colossal as the population they're trying to develop.
    • Decision next turn to lock in peacetime AP to support the Concordat for a decade +

    [X] Auto-locked: Battle Armor Factory rebuild.
    With the first few days of Q3 having seen the Helghan government make the difficult decision to scrutinise the battle armour production lines that, last quarter, had proven so flawed and to rebuild them no matter the cost, it came as no surprise when subsequent days saw the Republic do just that. Reluctantly handing over many millions of Marks and rather more energetically making clear just how interested the Prime Minister and their colleagues were in restoring production, Helghan's government immediately ordered a thorough analysis be carried out, a team assembled in a matter of weeks given full authority to investigate the top secret facilities. Comprised of some of the best analysts and industrial investigators in the nation, the team—most of whom ordinarily work for the Zulim Taw Battlemech and Jezero Nuclear Weapons factories—all but turned the battle armour facilities on their heads, every inch of the small batch high-tech manufacturing centres placed under intense scrutiny.

    Despite some within the Gemini government fearing that the problems experienced with battle armour production might prove inherent to the designs, the intense scrutiny provided by the investigators soon picked out a small but critical number of flaws in the manufacturing processes used. For example, nanometer-scale errors in the seed crystals used to construct the semi-crystalline armour plates of the battle armour designs resulted in brittleness throughout the entire structure that left them vulnerable to a well-placed strike, and the vagaries of quantum teleportation saw a line of control chips rendered useless. With the errors responsible for the production failures so identified, it proved simple to redesign said processes to avoid the flaws: a new method of creating seed crystals devised by Republic chemists in record time and a less capable but substantially more rugged line of processors substituted.

    Though delayed by the manufacturing flaws of last quarter, September's final weeks saw the first set of Helghan-produced battle armour step off the line to much acclaim; dozens more exactly like it and just as capable waiting just behind it.

    Effect
    • Production processes analysed and factories rebuilt. Helghan is now building its own version of (very basic) Battle Armour.

    [X] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessels to Clan-held regions will improve the ORDI's ability to gather information substantially.
    Keen to build on the earlier successes enjoyed by Operation Santiago's intelligence division, Q3 3050 saw Commodore Ostergaard argue for and receive a substantial force of additional spy ships—more than a dozen of the stealthy vessels leaving Helghan slipways and making for the distant site of the Clan Invasion. Transported to their destination thanks to the Command Circuit established through ComStar-controlled space, mid-August saw the fourteen vessels arrive in the region with studiously little fanfare. Quickly shuffled onto those same vessels that had so successfully deployed spy satellites sometime earlier, the subsequent weeks bore witness to a litany of successful insertions in a wide array of Clan held systems—the wealth of data already flowing back to Santiago Command only increasing as ship after ship deployed their sensors and drank deep from the well of insight, the Clans' would-be hunters seemingly none the wiser.

    Effect
    • Additional spy ships deployed to the Clan invasion front.

    [X] Establish a continuing effort to provide propaganda relating to the Clan war effort (lock 1 AP to propaganda)
    To the great relief of the Helghan government—members of which had seen public support for Operation Santiago decline in almost perfect opposition to the rising number of bodies returning home from the front—the July-September period saw a slight stabilisation of popular sentiment towards the conflict. Though notoriously difficult to pinpoint an exact cause for the change in attitude, random polls combined with more sophisticated analysis tools suggest that the principal driver of this stabilisation has been a combination of the cessation of Clan offensives and the small but noteworthy success of their Inner Sphere counterparts. These successes, combined with an ever-shifting media campaign engineered by some of the best message makers and communicators in the Republic, appear to have driven the human cost of the war from the minds of many ordinary citizens; excitement over the hard-won victories wrenched out of the hands of Clans Wolf, Jade Falcon, Coyote, et al., somewhat reinvigorating the original energy that drove Helghan's intervention.

    However, to the great distress of those who hoped (and continue to hope) for a complete 180 change in attitude, an end-of-quarter analysis conducted by those same media teams responsible for the Republic's ongoing propaganda campaign has suggested that this attitude adjustment may be as fragile as spun sugar. According to the analysis in question, the multiple conflicts the Republic has involved itself in over the years, the distance to the frontline, the currently minimal threat to the ORDI, and the overall cost of the conflict in terms of lives have resulted in a steadily growing exhaustion among even those ideologically inclined to support Operation Santiago. Should the Clan assault become reinvigorated, something Helghan military figures have indicated is probable if additional Clans join the invasion, the recent sentiment gains would likely be wiped out overnight.

    Effect
    • Republic propaganda eeked out a stabilisation in war exhaustion for this quarter.
    • Analysis of the data suggest that a renewed clan assault on the Inner Sphere could destroy this gain, however. That said, as the Clans threaten the ORDI more and more, people would likely support the war effort more.

    [X] Lothan Factory Complex Construction: As expensive as it will be, constructing a factory complex on Lothan will provide ORDI forces with an additional source of spare parts. [Progress: 0/10] [Locked Until Completed] [+1 AP from Capellan Confederation]
    With negotiations with the Free Rasalhague Republic's parliament having concluded more than satisfactorily from the point of view of its Helghan counterpart, early July saw the Republic order the construction of a factory complex in the Rasalhagian system of Lothan as part of an effort to provide further aid to the eternally resource-starved forces of Operation Santiago. Located at the end of a lengthy supply chain—one whose transports were almost entirely dedicated to the transfer of expendables such as munitions, spare parts, and more—the Lothan Complex was well understood to pose a tremendous challenge to those tasked with its construction from its very conception, the huge number of workers and vast quantities of resources required merely the most obvious of the problems Helghan logisticians faced. Undoubtedly cursing their bosses all the while, said logisticians nonetheless rose to the occasion, and mid-July saw the first battalions of Helghan workers shipped off to Lothan to join their military brethren.

    Arriving a little over a month later—their transport vessels having stopped only to pick up Capellan-manufactured machinery forwarded to Tsitsang—this small force of workers immediately threw themselves into laying the factory's foundations. Envisioned as a manufacturing centre comparable to that built on the Lyran planet of Fort Loudon, work proceeded apace despite the small number of workers devoted to the task. Working feverishly, workers from Helghan and Rasalhague alike pushed themselves to heroic extremes to keep on schedule, late August seeing a highway leading from the planetary spaceport to the provisioned land completed on time, while September's final days were closed out with the sinking of a colossal ferrocrete plug into the soft earth to serve as an anchor for the planned assembly lines.

    [Progress: 0/10] → [Progress: 2/10]

    Effect
    • Work starts on the Lothan factory

    [X] Operation Santiago
    -[X] Continue the standard rotation of fresh forces and equipment via Command Circuit as practical and necessary to account for losses faced in the last quarter.
    -[X] Begin digging in on the recaptured worlds. Given the strategic realities of the day, that the Clans cannot push closer to their goal in Sol without eliminating the threat posed by ORDI's Navy, encourage the Lyrans to help reinforce this part of the invasion corridor as opposed to resuming a counter-offensive that's just going to get reversed in six to nine months. If the Clans are aiming to concentrate enough force to overwhelm the largest fleet on the Inner-Sphere's side before sweeping past everyone else like a tide toward Terra, what's the point of grinding your troops to dust against Clanner garrison forces who have mostly been so suicidally stubborn as to prefer death to surrender?
    -[X] Anticipating that the Lyrans will likely ignore our warnings, we instead focus our energies on those who are directly threatened or directly involved enough that they can't ignore our requests out of hand. To the Wolf Dragoons, encourage them toward raiding activities, with an aim toward low traction, and high impact, something their aggressive maneuvers and battle wheeling slash dealing seem to be built for. We'll provide the minimal amount of support necessary to ensure their efforts aren't wasted (warship support that can be spared, some amount of units with preference given toward who the Dragoons think they'd work best with or could make best use of).
    Entering the new quarter with a growing sense that the other shoe was bound to drop sooner rather than later, mid-3050 saw a marked change in tack from previous months for ORDI's Operation Santiago, Commodore Ostergard ordering the forces under his command to cease offensive operations and begin preparing for a renewed Clan assault. Left bruised and battered from earlier battles but ultimately unbroken by the losses sustained, forces across the systems recaptured during the ORDI's recent counterattack rushed to obey the Commodore's orders—field fortifications sprouting up and down the lightyears-long front as engineering units dug vast fields of trenches, poured oceans of ferrocrete, and otherwise constructed an uncountable array of depots and other hardpoints. Though by no means equivalent to the Gunzburg Line, each passing month saw allied troops across the ten recovered systems entrench themselves ever deeper into their respective planets; the pause additionally allowed ORDI troops time for much-needed recovery. Primarily driven by the man's instincts as a military officer and supported by reports derived from the POW camp on Cassilda and comments from Star Commodore Eva Sukhanov—the woman one of a handful of Clan prisoners kept nearby due to their value as intelligence assets—the move earned Ostergaard no small amount of ire from the alliance's more militant politicians and a substantially greater deal more relief from those concerned with rising casualty rates and the vulnerability of exposed units.

    Meanwhile, as fortifications rose, ORDI's diplomats reached out to their Lyran counterparts in the hopes of convincing the state to end its counterattack against the Clans. Ordinarily not concerned with the fates of Inner Sphere states and more than happy to see the Clans losing systems, the same instincts that had impelled Commodore Ostergaard to cease offensive operations in Q3 had similarly blossomed throughout the militaries of the interstellar alliance and led to much unease throughout the five governments. Greatly concerned over the dear cost of the LCAF's ongoing counterattack and fearing that the losses had left the LCAF brittle, the ORDI's governments found themselves unexpectedly worried that the resumption of the Clan invasion could shatter the Lyran defences entirely and render the coreward state ripe for the Clans' picking.

    Unfortunately for those who judged the ORDI's diplomatic influence to be a potent draught, though the Lyran government proved willing to hear the alliance out, the mighty state nonetheless declined to halt its coreward offensive. In a private meeting between senior diplomats, the Lyran representative reluctantly made clear that while the LCAF and Archon agreed with the ORDI analysis, public morale and simple security concerns meant that neither could stop the assault yet. An ill-omened response, all things considered, the Lyrans' refusal to halt the coreward attacks was tempered by subsequent reports of engineering units constructing fortifications aplenty in the wake of the continuing vanguard and on vital strategic and industrial hubs.

    Perplexed by the sudden return of a defensive mindset in the wake of multiple glorious victories, the leader of Wolf's Dragoons, Jamie Wolf, proved notably less understanding of the change toward a defensive stance; reports of heated arguments between the ex-Clanner and Samuel Ostergaard making their way back to Helghan in record time. Rarely one to let emotions cloud his judgement, the mercenary commander's outbursts provoked more than a little concern for the working relationship between the alliance and the mercenaries, something about the invading Wolves evoking great distaste in their would-be spies and catspaws. Meanwhile, reports on the Dragoons' mood as a whole suggested that Jamie's anger was not merely shared by those under his command but typified the more restrained reaction; the famed Natasha Kerensky responsible for at least one bar room brawl thanks to her incendiary comments on the bravery of ORDI troops. Fortunately for all involved, an off-the-cuff comment from a headquarters clerk soon provided the answer to the conflict between Wolf and Ostergaard—the idea to have the Dragoons harry Clan Wolf forces rapidly seized by both parties and put into action.

    More than eager to fight their erstwhile brothers and sisters in arms, the three-month period saw a spate of raids launched by the Dragoons against their chosen foe; what forces Ostergaard could spare accompanying them to provide fire support. Easily on par with their Clan opponents in skill, if not better, the five raiding parties dispatched by Jamie Wolf crashed down upon the still-listless invaders in a series of Trials of Possession and took them for all they were worth. Fought according to Clan traditions and with scrupulous fairness, the Dragoons won duel after duel after duel against the invaders, the quarter's close seeing four out of five of the raiding parties making out like bandits and the fifth losing nothing that couldn't be easily replaced.

    Effect
    • Change in strategy works well given rising fears of a counter attack. Troops begin to dig in pretty readily; various field fortifications rising all over the recaptured territories. More work will be needed later, but ORDI forces are hella dug in.
    • Arguments ensue with the Dragoons, but they eventually agree to switch to a raiding tactic, the mood improving substantially on both sides when someone suggests looting as much clan equipment as possible via challenges. Raids go from okay to very well on all but one system. One system sees Dragoons eat shit
    • Lyrans kind of reject the recommendation to stop the counter attack. They make clear that it's a necessity for morale to do. Nonetheless, rear line units are spotted digging in all over the place behind the vanguard

    [X] Ask ComStar for more help with holding the line. What form that takes we're not sure, but at this point, it's blindingly obvious that either we stop the next wave of attacks in the Free Republic, or they'll be looking at occupiers.
    With anxiety over the resumption of the Clan Invasion growing almost daily across the Inner Sphere and reports from military analysts painting a grim picture of the Free Rasalhague Republic's ability to fend off the Clanners even with the aid granted to it by the Republic, mid-3050 saw the Helghan government riven with arguments over what to do; back-and-forth debates raging throughout Parliament and Pyrrhus' countless other halls of power as politicians and civil servants sought a solution to their problems. With some factions unwilling to withdraw troops from the front lines out of fear of what the Clans would accomplish without the bulwark of the ORDI blocking them, others equally unhappy at the thought of Clan MechWarriors rampaging through the green formations and almost all wary of shifting into a war economy, the quarter's first few weeks saw Helghan all but paralysed on the matter, no side able to do much more than irritate its opponents and shore up support among its proponents. Initially seeming little more than a means to burn off anxiety among the Republic's more skittish parliamentarians to those watching from the sidelines, the debates swiftly grew in scope and hostility as each side drew up their battlelines and dug deep their trenches until, at long last, some canny members brought up ComStar's recent actions.

    Seizing the mention of ComStar like a lifeline, Gemini Malkiewicz quickly moved to stifle the debate before it could grow even hotter, a message dispatched to the quasi-religious communications organisation asking for it to intercede on the Inner Sphere's behalf. Leaving the nature of said intercession up to interpretation—the more optimistic members of parliament reading into it a call for military action and the more pessimistic nothing but a sop to quieten the former—the message arrived on Terra mere days after dispatch, the high price charged for priority transmission more than worth it in the eyes of the government. Alas, much to the disappointment of those who hoped for an answer to all their problems, one did not prove forthcoming.

    Responding to Prime Minister Malkiewicz's request with a politeness no doubt perfected over decades of leadership, a recording of Primus Everson regretfully reported that ComStar would make no move to assist the ORDI in waging war against the Clans. Furthermore, the recording made clear that ComStar's reputation as a neutral party and its origin as a descendant of the Star League was all that prevented the Clans from seizing control of HPGs in the region and that the organisation would do nothing to jeopardise this reputation. Delivered by hand to the Office of the Prime Minister and categorically rejecting the idea of assisting the Inner Sphere in its defence against the Clans in spite of ComStar's recent moves to secure arms and troops, the message would have left the Republic's leaders simultaneously despondent and enraged were it not for the hidden message contained with the missive's audio.

    Uncovered by a routine scan of the recording's audio track prior to being played for the Prime Minister, ComStar's secret message—once provided to those who needed to know—proved rather more interesting than its public one. Promising nothing but hinting at something, the hidden text asked the Republic to bide its time for the next few months as ComStar prepared... something. Warning the Republic that the Clan Invasion was bound to restart momentarily, the message, signed with the Precentor-Martial's name, asked only that the ORDI buy as much time as it could for the Free Republic.

    Effect
    • ComStar responds with a message saying that it cannot breach its neutrality for fear of Clan retaliation
    • ComStar's secret message, meanwhile, asks for the Republic/ORDI to buy as much time as it can.


    Design and Requisition



    News and Rumours
    Helghan
    As with past months, September 3050 saw refugee numbers continue to climb in the Periphery, with two million additional people entering ORDI compared to last quarter.

    Predicted Refugee Acceptance Breakdown For 3050 (+-5%)
    Helghan Republic:     26,950,000
    Aurigan Coalition: 2,200,000
    Capellan Confederation: 12,000,000
    Magistracy of Canopus: 5,500,000
    Taurian Concordat: 3,900,000


    To the great interest of military and governmental figures throughout the nation, the continued rotation of experienced soldiers back to the Republic from the frontlines of the Clan Invasion has paid dividends in terms of tactics, training, and military engineering; reports from the military suggest readiness is at an all-time high. Having developed an understanding of Clan psychology and tactics in the crucible of war, veterans of the Invasion turned training officers have been relentless in drilling their trainees in the dos and don'ts of Clan warfare, the lessons lending Republic soldiers a keener understanding of the Clanner mind and an insight into what they value. Somewhat more prosaically, these soldiers have also provided much-needed feedback on equipment used throughout Operation Santiago, their suggestions, personal modifications, and robust opinions on design decisions since taken into account by manufacturers.


    In news from the civilian sector, Q3 3050 saw the release of Helmut Brecht's historical epic Triumph! to much acclaim. Set in the mid-21st century and showcasing the slow spiral of human civilization towards WW3 in the face of a worsening climate and an oil crisis, Triumph! proved both a critical darling and a success with audiences throughout the Periphery. Following Captain James Mallory as he commands the ballistic missile submarine USS Colorado and his family in the conflict's lead-up, the film ends with the launch of the submarine's nuclear weapons against Russian and Chinese targets.

    Competing with a Taurian reimagining of H.G Wells' War of the Worlds that saw alien invaders strike against ORDI states from the rimward edge, Triumph! proved unexpectedly successful among Helghan audiences. Earning back its budget in under a week via Helghan ticket sales alone, the success of the film within the Republic compared to the War of the Worlds' more standard fare has suggested to some that Helghan audiences are seeking something of an escape from the present.


    Aurigan Coalition
    Of substantial interest to the galaxy's spacecraft enthusiasts, September 3050 also saw the launch of the Aurigan Coalition's Wa'a Kaulua class exploration vessel Wa'a Kaulua. Named for the type of double-hulled exploration craft used by Polynesian explorers in ancient times, the Wa'a Kaulua is a purpose-built long-range exploration vessel theoretically capable of travelling more than 1,500 lightyears without taking onboard supplies from external sources; hydroponics bays and manufacturing facilities allowing it to extend this time even further. Launched from Mechdur's JumpShip yard, the first example of the 200,000-ton design passed its initial evaluations with flying colours and much acclaim before making for the system's zenith point. According to info sheets distributed by the Arano government to all who witnessed the ship's launch first-hand or tuned in to watch it via the ORDI's ever-growing WarpComm network, the Wa'a Kaulua will spend the next year or so travelling from Mechdur to the Taurian system of Gaul and from Gaul to the Canopian system of Thraxa without external support—followed, of course, by a companion craft in the event of an incident.

    No doubt seeking to either take control of or create an emerging market, mid-August saw a conglomerate of aerospace manufacturers in the Aurigan Coalition reveal a new type of civilian freighter intended for the private market. Named for the region of space it is expected to operate in and designed to fill the gaps left behind by their bigger state-owned siblings, the Borderworld Series YX Dromedary is relatively small for a faster-than-light spaceship at only 150 metres in length but makes up for its diminutive stature with a sizeable cargo capacity, robust structure, and fuel-efficient warp drive. Massing only 25,000 tons and capable of landing on prepared cargo pads or in bodies of water, the Dromedary can deliver up to 5,000 tons of cargo to the surface of undeveloped worlds and support its crew of 53 for up to 6 months without trouble. Priced low enough that private actors such as major corporations can afford to operate them, Dromedary freighters to the open market could trigger economic growth throughout the Periphery as previously non-viable trade connections develop. However, their paltry armament and almost non-existent armour render the design unsuitable for use in regions without reliable space patrols, and some on Helghan have already commented that this will prove the vessel's downfall.


    Capellan Confederation
    As in prior quarters, late September saw the Republic's coreward ally unleash a number of warships on the galaxy; an astounding sixteen Carson II class frigates joined the ten already operated by the state. More than doubling the size of the Capellan navy, the sixteen vessels immediately underwent shakedown cruises across the nation's borders with the Free Worlds League and the Federated Suns, and what few issues were discovered quickly resolved. Seemingly satisfied with the production capabilities of its planetside shipyards—at least, for now, anyway—the quarter saw no additional 500-kt slipways opened. However, work on 1-mt orbital slipways seemed only to increase, and estimates by Helghan's analytics corps suggest that two will be completed by the year's end.


    In a sign of blossoming inter-ORDI relationships, the July-September period also saw the Capellan Confederation dispatch a select group of orbital engineers to the Taurian Concordat to tour the nation's capable civilian shipbuilding industry. According to the itinerary handed to the Republic and its allies, the Confederation's engineers will spend the next twelve months touring the Concordat and visiting everything from dropship manufacturers to private spacecraft manufacturers. Though rather mundane in the abstract, the month-long block in the itinerary devoted to visiting the still-under-construction O'Neill cylinder in the Burton system has proven of interest to the engineer's Helghan counterparts; suggestions that the Confederation may look to construct similar habitats reaching the ears of politicians throughout the Republic.


    To the dissatisfaction of many of the Republic's industrial leaders and industry-leveraging politicians, August 3050 saw the Capellan Confederation announce the creation of a state-owned enterprise dedicated to manufacturing ultraheavy vehicles for civilian purposes. Written into existence as the Sarna Enterprise for Ultraheavy Manufacturing and based, understandably, in the Confederation's Sarna system, the SEUM inherited several formerly-state managed factories and a solid cadre of workers, designers, engineers, and associated figures. Not, on the face of it, a move that would annoy figures within the Republic, the enterprise's subsequent announcement that its first product would be a mobile factory with capabilities equivalent to the Horus MK I proved somewhat worrisome to a nation that had so successfully leveraged the use of such for diplomatic purposes. While so far playing the ultimate design of the proposed mobile factory close to its chest, SEUM has thus far intimated that it will be akin to earlier generations of Helghan mobile factories in overall design; the vital factory core situated atop a tracked base capable of crawling over most kinds of terrain.


    Magistracy of Canopus
    Shocking no one, September 3050 saw the Canopian navy welcome three additional Canopus class frigates into its order of battle, the three 500,000-ton vessels bringing the total number of such frigates in the Canopian military to twelve. Equipped with energy shielding thanks to the generosity of the Helghan Republic and capable of undertaking a wide range of mission profiles, the new Canopus class have since been spotted undergoing extended shakedown cruises across the Magistracy's rimward border. Similarly, September also saw the completion of three additional planetside slipways for the Magistracy, Canopian workers completing their labours in impressive time and bringing the total number of such slipways to twelve.

    Somewhat more surprisingly, the Canopian military has, at the explicit request of Magestrix Emma Centralla, also informed the nation's allies that it is interested in developing a Kearny-Fuchida drive-equipped warship for production within the next few years. An extreme divergence from the warp drive-equipped designs that have thus far typified ORDI warships due to their utility in the high-speed, short-distance conflicts the ORDI has almost exclusively fought to date, such a vessel would be worse in all regards bar one: long-range endurance. While the Magistracy has placed few restrictions on what such a vessel should feature beyond it being able to outfight warships of a similar tonnage and travel a comparable distance to the Aurigan's Wa'a Kaulua class exploration vessel, the mere fact that the state has raised the matter has left many within the alliance—the Republic included—confused.


    In news of particular interest to Helghan geneticists and somewhat lesser interest to Helghan ethnologists, the same period saw preliminary results from those Canopian geneticists working on Cassilda arrive in the Republic. Though limited in their findings due to the short period available for them to work, Canopian scientists involved in sequencing, identifying, and cataloguing Clan genetics have nonetheless produced several fascinating insights into the genetics of Clan warriors and civilian castes; breakdowns of common genes poured over by geneticists throughout the ORDI. Considered the most complete due to the relative availability of sources, the genetic structures of Clan MechWarriors and Elementals are perhaps the most well-understood of those studied, and Aerospace Pilots and Technicians the next most.

    Far from inhuman—the genetic alterations made by Clan scientists reportedly limited in the minds of the Magistracy's more ambitious scientists—said alterations are nonetheless wide-ranging and well-implemented. According to those in the Republic who specialise in such matters, Clan scientists have not only implanted genes associated with reduced lactic acid buildup into the genomes of Clan Warriors but also improved the functioning of their immune system, cardiovascular system, kidneys, and liver through the same route. Unsurprisingly, these same genes have appeared in the sequences of those few civilian Clanners available to the Canopians, though some show signs of sexual inheritance rather than artificial insertion. While far from producing colossal improvements over ordinary humans—the genes themselves entirely sourced from humans, though not naturally present in this particular configuration or quantity—they nonetheless work to make Clan bodies more efficient in many regards and, when combined with the Clans' bloodthirsty treatment of those who fail to measure up to their supposed genetic potential, an appalling commitment to eugenics.

    Somewhat interestingly, the addition of these genes has had the side effect of spawning previously rare receptors in the cells of Clan bodies; said receptors regulate various processes and either reduce or increase the uptake of substances. Shared with populations throughout the known galaxy, primarily those that experienced periods of isolation that allowed said genes to become ubiquitous or semi-ubiquitous before contact was reestablished, the presence of these receptors has garnered the interest of the Republic's security services. Included as a final hurdle in the battery of tests and checks run by such services to catch spies, a test for these receptors could help the Republic's intelligence service guard against infiltration by the Clans, though not even they consider it a silver bullet.


    Taurian Concordat
    Echoing prior months, September 3050 has seen the Taurian navy welcoming nine Auroch class Frigates into its ranks, the heavily armed vessels joining those already patrolling the rimward Periphery. Simultaneously, Taurian workers completed efforts to convert the nation's remaining two 200,000-ton slipways into their bigger siblings; their labours brought the total number of planetary slipways to fourteen. Increasingly viewed as an unnecessary expenditure by those within the recently absorbed and impoverished Outback region, the news of both has resulted in a handful of minor protests within the Pleiades Cluster and its surrounds and mild critique by the less militant sections of Taurian media.

    Understandably, the mood in the region has continued to sour over the quarter, and rumblings of discontent have grown ever more frequent from those who view the Concordat as either backtracking or simply not delivering on promises made following the Outback intervention. To combat this rising tide of disquiet, the Concordat has, to the irritation of some Helghan politicians, begun publicising the nation's recent aid offer. While this has reportedly served to somewhat cool tempers within the region, it has proven far from halting the rise of discontent and left the Republic in an awkward position should it find its industries taxed by the war effort.


    In much more positive news from the Republic's spinward ally, late Q3 saw the superstructure of the still-under-construction O'Neill Cylinder in the Burton system completed with much fanfare; champagne and other drinks flowing in copious quantities. Started in January 3045 by a conglomerate of companies that have since been discovered to be closely associated with the Concordat's Far-Looker movement, the completion of the habitat's shell represents a significant step toward completion and is undoubtedly the reason for the recently organised visit by Capellan engineers and associates. Beginning life as little more than a collection of scaffolds attached to an M-type asteroid, the half-decade since its conception saw the habitat—since named Corinth as an ode to the neighbouring Sparta habitat—swell in size until it became a cylinder three kilometres wide and twelve long. Constructed out of a nickel alloy sourced from its host asteroid and the swarm of asteroids manoeuvred into position following the exhaustion of said host, tens of thousands of Taurian workers laboured around the clock to construct the vast edifice.

    Massing over 2,500,000,000 tons and featuring three mirrored arms designed to reflect sunlight into the interior via transparent windows—each a compound window constructed from numerous panes of multi-metre thick glass—Corinth has become an emblem of Taurian accomplishment despite its status as a work in progress. Two kilometres wider and five kilometres longer than the Star League's O'Neill Station, citizens across the Concordat have received the news of Corinth's good progress with much celebration, a vast upswell of interest emerging alongside reports of the shell's completion. Intending to open the megastructure's interior to pioneers by the end of 3052, the conglomerate responsible for Corinth's construction has taken a leaf out of the Republic's book and manoeuvred a series of chondritic asteroids near the habitat to use as feedstock for the interior landscape and to fill both the atmosphere and circumfluous sea/salt-water resolver.


    Clan Invasion (Varied)
    In line with their statements to the Helghan Republic, the year's third quarter saw the Lyran Commonwealth continue its counterattack into Clan-held systems, mercenaries and regular troops alike lancing forth to strike at those systems rendered vulnerable by prior efforts. The greatest effort yet attempted by the LCAF, the assault crashed down upon the Fire Mandrills and Coyotes like a tsunami of steel, the flotilla of dropships involved kept safe from harm by the nation's newly produced Thor-class frigates and the Republic's own Nocti. Fought by veteran troops supported by unblooded reinforcements from the nation's core, the multi-pronged assault saw vicious fighting across a front more than seventy lightyears wide and forty lightyears deep, nine of the ten targeted systems falling by September's end. Though the price exacted by the Clan defenders proved high—reports indicating that some Lyran units sustained upwards of 40% casualties—the overall success of the counterattack was met with jubilation by a fearful populace; impromptu celebrations held and those on what had previously been the frontlines letting out a collective sigh of relief.


    Likewise, the Draconis Combine continued its counterattack throughout the same period, multiple regiments of the nation's most experienced and best-equipped troops thrown at the frighteningly effective Jade Falcons in the hopes of pushing the Clanners away from the soon-to-be-completed shipyards at Luthien, Avon, and Asgard—Asgard's shipyards, of course, having been preserved by the Falcons during their assault and recaptured soon after. Supported by ORDI warships lest the Clans try to intercept the forces when they were at their most vulnerable, DCMS troops landed on Mualang, Yamarovka, Itabaiana, and Caripare within days of one another, the fighting that followed reportedly reaping a terrible toll. Though information on what exactly occurred proved challenging to find, analysis of the subsequent rumours and the Combine's propaganda output painted the picture of furious fighting and heroic efforts from MechWarriors on both sides, Falcon resistance so staunch that it took until late August for the last Clanners to surrender or die and for the DCMS to move on to Soverzene and Thessalonika.

    No doubt hoping to replicate their earlier successes, the DCMS quickly found Falcon resistance even more immovable than it had proven on Mualang or Itabaiana; Falcon aerospace fighters willing to engage in nigh-suicidal strikes against descending dropships and scoring several vital kills in the process. Though fighting would continue for several weeks as the two sides sought out areas of weakness, late September eventually saw the DCMS conduct an organised withdrawal from both systems. While information as to why the normally aggressive Combine military might do such a thing is understandably scarce, what few experts in the Combine the ORDI can boast have suggested that this is nothing more than the influence of Coordinator Theodore Kurita at work, the man well-known for his views on the DCMS' traditional ways of waging war.


    Federated Suns
    As has become almost rote, the July-September period saw the Federated Suns launch four additional Reynard class destroyers from its planetary shipyards on Augusta and Numenor. Concluding their shakedown cruises without incident, the four warships have joined the sixteen already present in carrying out anti-piracy patrols in the nation's spinward expanse; Helghan spies within the Suns reporting that they've seen good results in their efforts thus far.

    Meanwhile, the same period has seen the Federated Suns complete work on four 500,000-ton capacity slipways, one slipway located on Augusta, Numenor, Markesan, and New Avalon. Likewise, FedSun workers on Augusta and Numenor have finished the effort to complete two additional 200,000-ton capacity slipways. However, talk within the Palace has made it abundantly clear that the Federated Suns will convert all eight 200kt slipways to 500kt slipways to take advantage of the latter's greater shipbuilding utility.


    Free Worlds League
    Of interest to many throughout the Outer Rim Defence Initiative, the July-September period saw the launch of a quarter of warships from the Free Worlds League's shipyards on Alterf, Atreus, Hellos Minor, and Regulus, ORDI spies losing track of the vessels shortly after they departed for their shakedown cruises. Announced to be Valor class frigates by the Captain-General in a speech broadcast via the nation's continually expanding FTL comms network and ComStar's own HPG system, images recorded by what spies the ORDI has within the League have been poured over relentlessly by the alliance's various intelligence agencies. While information on the vessels is scarce, a rough outline of the class' capabilities has been determined.

    Code: 
    Class/Model/Name:    Valor class Frigate
Mass:    500000 tons

Equipment                                               Mass
Engine:    Fusion Engine                                    ?0000
Safe Thrust:    ?  
Maximum Thrust:    ?  
Structural Integrity:    ???                            ?????
Total Heat Sinks:    ???? ????   [????]              ????
Bridge, Controls, Radar, Computer & Attitude Thrusters  1250
Fire Control Computers                                    ?
Food & Water (180 days supply)                            1622
Spare Parts (? percent)                                    ????
Fuel & Fuel Pumps (????? Points)                        ?????
Standard Warp Drive (?? Integrity)                      226250
Armor:    Standard (??? total armor pts)                    ????

Capital Scale Armor  
Front            ??  
Fore-Left/Right    ??/??  
Aft-Left/Right    ??/??  
Aft            ??  

Bays and Cargo:      
  Bay 1:    ?? Small Craft Bay with 2 doors             ????
  Bay 2:    ?? Fighter Bay with 2 doors                 ????
  Bay 3:    ?? Fighter Bay with 2 doors                 ????
  Bay 4:    Cargo Bay (Standard) with 2 doors           ????

Dropship Capacity:    10                                  10000

Life Boats:    67    0

Crew:      
100+      Crew (120 minimum)                              ???
20-40      Officers (25 minimum)                           ???
??      Specialists (6 minimum)                         ???
???      Bay Personnel                                   ???
50-100  Gunners (6 minimum)                             ???


        Weapons & Equipment         Loc        SRV        MRV        LRV        ERV        Heat        Mass
??    Laser AMS                   Nose       0(0)       0(0)       0(0)       0(0)       ???         ??
5    NL55                        Nose       28(275)    28(275)    28(275)    28(275)    425         5500
?    H-Medium Laser              Nose       ?????      ?????      ?????      0(0)       ??          ?
??    Laser AMS                   FL/R       0(0)       0(0)       0(0)       0(0)       ???         ??
5    NL55                        FL/R       28(275)    28(275)    28(275)    28(275)    850         11000
?    White Shark ???????????     FL/R       ???????    ???????    ???????    ???????    ???         ???
?    H-Medium Laser              FL/R       ?????      ?????      ?????      0(0)       ??          ??
??    Laser AMS                   L/RBS      0(0)       0(0)       0(0)       0(0)       ???         ??
5    NL55                        L/RBS      28(275)    28(275)    28(275)    28(275)    850         11000
?    White Shark ???????????     L/RBS      ???????    ???????    ???????    ???????    ???         ???
?    H-Medium Laser              L/RBS      ?????      ?????      ?????      0(0)       ??          ??
??    Laser AMS                   AL/R       0(0)       0(0)       0(0)       0(0)       ???         ??
5    NL55                        AL/R       28(275)    28(275)    28(275)    28(275)    850         11000
?    White Shark ???????????     AL/R       ???????    ???????    ???????    ???????    ???         ???
?    H-Medium Laser              AL/R       ?????      ?????      ?????      0(0)       ??          ??
??    Laser AMS                   Aft        0(0)       0(0)       0(0)       0(0)       ???         ??
4    NL55                        Aft        22(220)    22(220)    22(220)    22(220)    340         4400
?    H-Medium Laser              Aft        ?????      ?????      ?????      0(0)       ??          ?
                              
    TOTALS:                                206        206        206        191        4925        52500


    Lyran Commonwealth
    As in prior quarters, Q3 3050 saw the Lyran Commonwealth launch four more Thor-class frigates to join the eight already plying the space lanes. Representing a 30% increase of the forces available to the Lyran navy, the quartet of warships was quickly dispatched to guard key industrial sites in the path of the clan invasion; Helghan analysts predicted that the vessels would receive first rights to the bomb-pumped x-ray lasers the Lyrans have been busy purchasing from the Federated Suns. Still a long way from matching the Clans' supposed blackwater capabilities, the addition of so many warships to the Lyran order of battle is sure to slow the Clans' thus far incredible rate of advance through the Inner Sphere.


    To the great relief of Helghan decision-makers and Lyran citizens alike, the three-month period has seen the Lyran state devote incredible resources to fortifying those systems recently recaptured from the invading Clans. All across the expected route of follow-up assaults, LCAF engineer units and Lyran labourers have worked around the clock to dig trenches, build hardpoints, and pave runways into existence; the sheer amount of liquidity flowing from state coffers to the lower class counting as a roundabout form of social stimulus and prompting a surge of spending among members of said class despite fears of war. Though most such efforts have focused on those industrial planets previously staring down the barrel of Clan attacks, the LCAF has included the recently retaken systems of Graceland, Dustball, A Place, Morges, Babaeski, Antares, Graus, Sudeten, Dompaire, and Parakoila in the plan given the likelihood of clan units targeting them once more. While not particularly ambitious in their scope thanks to the time available, the sheer amount of fortifications built and their utility to local forces will no doubt hamper the Clan assaults that many within the Republic consider inevitable, said frustration hopefully proving the difference between victor and defeat for the Commonwealth.


    Draconis Combine
    Continuing trends from prior months, the June_September period saw the Draconis Combine continue to pull DCMS troops away from the nation's border with the Federated Suns; the undamaged units shovelled into the Clan frontline in job lots to fill gaps and bolster the nation's defences. A bold move considering the historic rivalry between the Combine and the Federated Suns—a rivalry punctuated with massacres and other atrocities, it must be said—the fact that First Prince Morgan Davion has yet to exploit the Combine's soft underbelly for the Suns' advantage has left many within the Republic and beyond puzzled as to why. Despite the access to the First Prince's Palace that the Republic currently enjoys, little information regarding the inaction on the AFFS part has reached the ears of the nation's spies, and so Helghan analysts have been left to speculate that a deal was reached between the Combine and the Suns sometime before the infiltration of the palace network. While such a deal would not last long, the mere fact that one would be signed—if one was signed—speaks to either the seriousness with which the First Prince is taking the Clan invasion or a newfound uncertainty in the AFFS's abilities.


    Appearing to reach the same conclusion as the Helghan Republic, Q3 3050 saw the Draconis Combine begin a massive effort to fortify its frontline with the Clan against assault; early July saw an army of civilians put to work constructing a wide array of defensive structures. According to propaganda broadcasts made by the Combine's media outlets, the hundreds of thousands of workers employed in the measure are, to person, all volunteers who willingly picked up tools after school and after work to do their patriotic duty and defend their homeland from the vicious invaders. While the Republic naturally has its doubts about the truth of such claims—especially when they portend to those prisoners claimed to have signed up for especially dangerous work—the effort's efficacy cannot be doubted; bunkers and hardpoints spotted springing up throughout the nation's coreward region.

    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship)

    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 18/18 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.95/4.0 [Base: 0.75] (use the transport size value)
      Navy (18/18 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 1 Pilum Battlecruiser (2 Capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 42 Commissar-B Pocket Warships (0 capacity)
      Ground (3.95/4.0 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight)
      • Fourth Division, First Army (0.5 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • 1 regular BattleMech regiment (0.1 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Beats Walking)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 4 Carson II-class Frigate (4 Capacity)
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 4 Auroch-class Frigate (4 Capacity)
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships

    Q3 Casualty Estimates
    CasualtiesTotalKilledInjured
    Helghan Republic Armed Forces000
    Aurigan Coalition Military000
    Taurian Defence Force000
    Magistracy Armed Forces000
    Capellan Confederation000
    Clan Invaders (Est.)000
    Civilians (Est.)000

    Casualties To Date
    CasualtiesTotalKilledInjuredMissing
    Helghan Republic Armed Forces5,3571,4403,344573
    Aurigan Coalition Military2,5646311,87162
    Taurian Defence Force3,74311082,492143
    Magistracy Armed Forces3,65510042,493158
    Capellan Confederation4,6611,3093,244108
    Clan Invaders (Est.)11,1004,600+6,500+--
    Civilians (Est.)115,60036,400+79,200+--


    Map of the Inner Sphere (End of September, 3050)

    Link to full size image here
     
    Last edited:
  • View discussion
    • The Clan Invasion -- October-December 3050 Actions
  • View content
    • The Rose and The Bull
    Impoverished for centuries by the ruthless exploitation of companies and nobility from the Federated Suns' imperial core, the people of the former Outback had been wanting for almost everything by the time the Concordat took charge of its myriad systems—electricity, clean water, labour-saving devices, and countless other mundane things typically only found in the region's cities, and even then only where they had benefited the region's past exploiters. Riding in with promises of hope and change as it took charge, Protector Calderon immediately moved to guarantee all the rights and responsibilities enshrined in the state's charter and lives once undreamt of now were almost close enough for the Concordat's newest citizens to taste.

    Alas, as many things are wont to do, this golden dream quickly tarnished before the eyes of its bearers as days turned to weeks and weeks turned to months, the promised future just as far away as it had ever been as the Concordat's prodigious industry proved unable to fulfil the ravenous hunger of a region that, in many places, still relied on horse and cart for transport. Having watched from the sidelines as hope began to curdle into cynicism and irritation over military expenditure began to blossom into anger, the Republic had quickly—and somewhat blithely—stepped in to offer assistance to the Concordat, Helghan promising to lend the strength of its industry to the effort in the hopes of curtailing ill-will and making good on the promises of the ORDI. Well aware of the problem's scale and his analysts' predictions, Protector Calderon had accepted the aid offer with barely a quibble, the Concordat sending the Republic a laundry list of goods and materials vital to the development effort within days of receiving the offer.

    Ranging from subsidies for communication gear to the delivery of agricultural machinery, the aid requested by the Taurians ran the gamut of industries and types, the sheer quantity threatening to absorb a mighty fraction of the Republic's industrial output. Lacking any estimation for when the development effort would be complete and with the threat of the Clan Invasion omnipresent in their minds, Republic politicians found themselves forced to play budgetary Tetris to support the Concordat's request; members of parliament soon debating if the Outback's people should receive cheap medicines or public transport, and if Operation Santiago could afford less support in the future if it meant that people on Caldwell could have heated homes next winter.

    How Much Aid Does The Republic Supply?
    OOC: There's no write-in option here as I don't want to read 300 words detailing exactly what you want to send :V (plus the only thing that matters in regards to cost is how much you're offering to send).

    [] Reluctantly withdraw offer [Will negatively impact the Concordat's opinion of the Republic]
    [] What We Can Spare. [-1 peacetime and -1 wartime AP indefinitely]
    [] A Solid Commitment. [-1 peacetime and -2 wartime AP indefinitely]
    [] Whatever It Takes. [-1 peacetime and -3 wartime AP indefinitely]

    Actions
    You have 6 out of 10 Action Points to spend. -1AP from Tikonov Command Circuit rental. -1AP from Free Worlds League Command Circuit rental. -1AP from Anti-Clan AgitProp effort. -1AP from Lothan Factory Complex Construction.

    This list of available actions is by no means exhaustive, so feel free to suggest more actions or variations on the actions listed below.

    Federated Suns:
    [] Expand FedSuns intelligence network: Having placed a large number of agents within the lower levels of FedSuns society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Stage diplomatic incident [Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/12 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Continue NAIS Infiltration [Medium-Hard]: Continuing prior efforts to infiltrate the New Avalon Institute of Science is vital if we want access to their latest designs and most secure production sites.
    [] Steal research [Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Further Infiltrate Davion Palace [Hard]: By infiltrating the Davion palace, we can gain access to its most vital secrets and most important people.
    [] Write-in:

    Lyran Commonwealth:
    [] Expand Lyran intelligence network: Having placed a large number of agents within the lower levels of Lyran society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Medium]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Steal research [Very Hard] [TARGET RESEARCH]: Utilising our agents in research centres and laboratories, we can "acquire" valuable research data.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Very Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]

    Free Worlds League:
    [] Expand League intelligence network: Having placed a large number of agents within the lower levels of League society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Hard]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Extremely Hard]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-10,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in (Convince me you've got something good)

    Draconis Combine:
    [] Arms Sales: With the Combine now at war, they may be willing to purchase items up to and including formerly LosTech ammunition from the Republic. Given the distances involved, such shipments will be very difficult until efforts are made to improve the backend logistics. [-5 influence]
    [] Tech for Tech: By offering the Combine information on [write-in] in exchange for what they know about [write-in], we may be able to bypass the costly and difficult effort of researching it for ourselves… provided they agree.
    [] Expand Combine intelligence network: Having placed a number of agents throughout Draconis society, now would be a good time to capitalise on the effort and expand the Republic's reach.
    [] Infiltrate Civil Administration [Hard]: By infiltrating the civilian leadership, we can improve our ability to ferment dissent amongst the populace.
    [] Ferment Dissent [Medium]: By producing and spreading certain forbidden materials throughout the people of this faction, our agents can potentially incite dissent against the powers-that-be.
    [] Infiltrate Military [Very Hard]: By infiltrating the military, we can more easily raid targets of opportunity, stage incidents, and gather intelligence on deployments.
    [] Stage diplomatic incident [Very Hard]: Through agents in positions of power, we can stage border incidents justifying military response.
    [] Orchestrate Coup [Impossible]: By training and arming those whose beliefs align with those of the Republic, we can remove those in charge and install elements friendly towards us. [Progress: 0/20 turns] [-15,000,000 C-Bills/turn] [Effectiveness increases and time decreases with dissent/support of Republic ideology]
    [] Write-in

    ORDI Actions
    [] Write-in

    Helghan Republic
    [X] Establish a continuing effort to provide propaganda relating to the Clan war effort [Ongoing]
    [] Construct a military defence station over [LOCATION]
    Locations available:
    • Cassilda
    [Can be taken multiple times in a turn]
    [] Upgrade a military defence station at [LOCATION]
    • Available stations:
    • Caliban (Medium → Large)
    • Charybdis (Medium → Large)
    • Highwater (Medium → Large)
    • Mir (Medium → Large)
    • Tiverton (Medium → Large)
    • Contrilla (Small → Medium)
    • Detroit (Small → Medium)
    • Mantharaka (Small → Medium)
    • New Oslo (Small → Medium)
    • Rogue (Small → Medium)
    • Spencer (Small → Medium)
    [Can be taken multiple times in a turn, but you can only upgrade a single station once per turn]
    [] Construct a Petrusite synthesis plant on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Helghan
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]
    [] Construct a secondary fleet anchorage on: [LOCATION] [Progress: 0/4]
    Locations Available:
    • Portland
    • Mir
    • Rogue
    • Independence
    • Charybdis
    • Detroit
    [Can be taken multiple times in a turn, but you can only build one per planet]

    Military
    [] Raise an Army: Task your military with forming an additional army. [Progress: 0/2] [Can be taken multiple times in a turn so long as there is recruitable population remaining]
    [] Construct two Hasta-class cruiser Squadrons: Task your shipyards with constructing three Hasta Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIIC-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIIC Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct two Hasta IIID-class cruiser Squadrons: Task your shipyards with constructing three Hasta IIID Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct one Noctis-class cruiser Squadrons: Task your shipyards with constructing six Noctis Cruisers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Damascus-Class Carrier Squadron: Task your shipyards with constructing a squadron of Damascus-Class Carriers. [Progress: 0/3] [Can be taken multiple times a turn]
    [] Construct a Toxotai-class Guided Missile Cruiser Squadron: Task your shipyards with constructing a squadron of Toxotai Guided Missile Cruisers. [Progress: 0/3] [Can be taken up to four times in a turn]
    [] Construct 4 Guardsman-class Pocket Warships: Task your shipyards with constructing 4 Guardsman-class pocket warships. [Can be taken multiple times a turn]
    [] Construct a Pilum-class Battlecruiser squadron: Task the Detroit shipyards with building a squadron of three Pilum-class battlecruisers. [Progress: 0/6] [Cannot construct other 1m+ ton designs until completed]
    [] Hecatoncheires-class Escort Carrier Squadron: Task your shipyards with constructing a squadron of Hecatoncheires-class Escort Carriers. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a MAWLR-II pack: Task your heavy industry with constructing a pack of three MAWLR-IIs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a SAHLR pack: Task your heavy industry with constructing a pack of three SAHLRs. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Forge pack: Task your heavy industry with constructing a pack of three Forges. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Hydra pack: Task your heavy industry with constructing a pack of three Hydras. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Dragon pack: Task your heavy industry with constructing a pack of three Dragons. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct a Pyrrhus pack: Task your heavy industry with constructing a pack of three Pyrrhuses. [Progress: 0/3] [Can be taken multiple times in a turn]
    [] Construct 2 Battlemech Battalions: Task Fisher & Zulim Taw with constructing 2 battalions worth of mechs.

    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.
    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship )
    Support Modifiers
    Navy    :
    • +2 (Make-Do Yardships)
    • +3 (Tsitsang Fleet Anchorage)
    • +5 (Decreased Distance)
    • +2 (Parthian-class Mobile Shipyard)
    • +2 (ComStar Command Circuit Route)
    • -2 (ORDI Donation)
    Ground Support Capacity:
    • +1 (Tsitsang Ground Facilities)
    • +0.75 (ComStar Command Circuit Route)
    • +0.25 (Fort Loudon)
    • +0.50 (Decreased Distance)
    • +1 (Forge Pack)
    • +0.50 (Forge Pack)
    • +0.25 (Forge Pack)
    • -1 (ORDI Donation)
    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent
    • Naval Support Capacity: 18/18 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.95/4.0 [Base: 0.75] (use the transport size value)
      Navy (18/18 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 1 Pilum Battlecruiser (2 Capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 42 Commissar-B Pocket Warships (0 capacity)
      Ground (3.95/4.0 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight)
      • Fourth Division, First Army (0.5 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • 1 regular BattleMech regiment (0.1 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Beats Walking)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 4 Carson II-class Frigate (4 Capacity)
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 4 Auroch-class Frigate (4 Capacity)
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships

    [] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessel's to Clan-held regions will improve the ORDI's ability to gather information substantially.
    [] Prioritise Naval Supplies: By prioritising the shipment of naval supplies over those for ground troops, we can further improve our ability to deploy naval forces to the Outback. [+1 Naval Support Capacity, -0.125 Ground Support Capacity]
    [] Prioritise Ground Supplies: By prioritising the shipment of supplies for ground troops over those of the navy, we can further improve our ability to deploy ground forces to the Outback. [+0.25 Ground Support Capacity, -0.5 Naval Support Capacity]
    [X] Lothan Factory Complex Construction: As expensive as it will be, constructing a factory complex on Lothan will provide ORDI forces with an additional source of spare parts. [Progress: 2/10] [Locked Until Completed] [+1 AP from Capellan Confederation]
    [] Swap Ground Supplies for construction materials (amount to trade): By replacing a percentage of the expendables bound for ground troops with construction materials, we can bring forward the completion date of the factory quite substantially. [Every 0.25 points of Ground Supplies traded gives a +5% modifier to the base value of Helghan AP used on the factory] [You can gain a max bonus of 25%. This bonus stacks with the naval version but does not apply to the one-time boosts.]
    [] Swap Naval Supplies for construction materials (amount to trade): By replacing a percentage of the expendables bound for naval forces with construction materials, we can bring forward the completion date of the factory quite substantially. [Every point of Naval Supplies traded gives a +5% modifier to the value of Helghan AP used on the factory] [You can gain a max bonus of 25%. This bonus stacks with the ground version but does not apply to the one-time boosts.]
    [] Rush Supplies to the Front V1: Though we can only afford to do it once, we can push our transport vessels to the limit and move additional construction materials to the front at the risk of wrecking a few engines. [+1 AP progress on construction] [-1 Naval Supplies, -0.3 Ground Supplies for this turn] [Picking this option locks out V2 and V3]
    [] Rush Supplies to the Front V2: Though we can only afford to do it once, we can push our transport vessels to the limit and move additional construction materials to the front at the risk of wrecking a few engines. [+2 AP progress on construction] [-2 Naval Supplies, -0.6 Ground Supplies for this turn] [Picking this option locks out V1 and V3]
    [] Rush Supplies to the Front V3: Though we can only afford to do it once, we can push our transport vessels to the limit and move additional construction materials to the front at the risk of wrecking a few engines. [+3 AP progress on construction] [-3 Naval Supplies, -0.9 Ground Supplies for this turn] [Picking this option locks out V1 and V2]
    [] Operation Santiago Phase 8 Objectives (Failure to detail new objectives for Operation Santiago will have me pick ones based on prior discussion) [You can have a max of 300 words and 2 if statements in this action.]

    Military Requisition And Design
    You have 4 out of 4 Requisition Points to spend on upgrading Helghan's ground forces. These upgrades are given to all active armies at once, though the more armies you have the longer it'll take to roll out changes.

    Requisition
    [] Flechette Charges: Designed by the Helghan Defence Corporation out of Bloemfontein, Flechette Charges are little more than directional command-detonated anti-personnel landmines attachable to the outer armour of a Battle Armour suit. Inspired, on the one hand, by the Anti-Personnel Pod's seen on Clan mechs and, on the other, the needle weapons so prevalent throughout the Inner Sphere, flechette charges send out a spray of explosively formed polymer-composite flechettes able to shred flesh and penetrate some light armours upon detonation. Intended for use in close-quarters combat or to clear the area below a leaping BA unit, flechette charges are one-time-use items but offer little to no additional risk.
    [] BA Spider Mine Dispenser: Essentially a scaled-down version of the mine dispensers used by Republic forces to deploy spider mines around secure areas, the BA Spider Mine Dispenser is securely attached to the back of a Battle Armour suit and allows its user to deploy more than a dozen mines on the battlefield at the click of a button. Easily reloaded via specially made cartridges and featuring a quick-release system for use if reload is unavailable or the backpack itself becomes a hazard, the BA Spider Mine Dispenser is a valuable bit of equipment for any Battle Armour squad.
    [] BA-scale Irradiated Petrusite Projector: A midway point between the infantry and mech version of the IP Projector, the Battle Armour-scale IP Projector is a short-range but incredibly deadly weapon able to pose a threat to mechs and their pilots… as well as infantry squads hunkered down in cover.

    Design
    [] KF-Drive Warship (One Time Only)
    [] Dropship Design: (tell me what you're trying to design)
    [] MAWLR Redesign: Order your design teams to redesign the MAWLR to make use of the latest technological advancements.
    [] Design write-in: Order your teams to design a solution to a capability gap. (tell me what you're trying to design)
     
    Last edited:
  • View discussion
    • The Clan Invasion -- October-December 3050 results
  • View content
    • [X] Plan: Build That Wall
    https://forums.sufficientvelocity.com/threads/the-lords-of-ruin-battletech-killzone.52819/page-1091?post=32116338#post-32116338
    [X] The Rose and the Bull
    -[X] A Solid Commitment. [-1 peacetime and -2 wartime AP indefinitely]
    Having promised the Taurian Concordat substantial support in developing the nation's newly integrated systems last quarter, the October-December period saw the Helghan Parliament called on by its Taurian counterparts to begin delivering said support. Only moderately disgruntled at the chit getting called in so soon, the Republic's varied ministers nonetheless moved to make good their vaguely worded promise; various government-owned supply chains ordered to prepare for a significant diversion of production even as the Republic's Parliament argued amongst itself regarding what items would be dispatched and in what quantity. Though initially resembling nothing more than a grab bag of ideas, information garnered last quarter combined with the Republic's own experience bootstrapping backwater systems to acceptable quality standards quickly saw a single plan take the lead, its proponents rewarded with seeing it pass through the Pyrrhic Parliament in record time.

    Representing both a solid commitment from the Helghan Republic and a respectable percentage of the nation's industrial output in a variety of areas, the agreed-upon plan saw the Republic agree to send everything from fusion powerplants to vaccines to the afflicted region, government-owned freighters collecting countless goods and setting off for the Concordat within days of the bill's passage. However, so great was the burden on Helghan industries that Republic economists quietly pointed out to their superiors that the nation would likely feel it both when carrying out national-scale infrastructure projects and when responding to crises such as the Clan Invasion, and estimations suggest that these restraints would continue for at least a decade, if not longer. Seemingly expecting a walk-back of the earlier promise, the reaction among both the Concordat people and its government to such a respectable response was, understandably, very positive, and Helghan's esteem rose higher with the Taurian public.

    Effect
    • Helghan agrees to provide a sizable amount of goods to the Concordat; government directives and investments seeing a large number of goods beginning to flow to the outback region.
    • Not a silver bullet, but should help keep tensions in check.
    • -1 peacetime AP, -2 wartime AP. Both indefinite (at least 10 years)

    [X] Construct 2 Battlemech Battalions: Task Fisher & Zulim Taw with constructing 2 battalions worth of mechs.

    Effect
    • +2 Battlemech battalions

    [X] Continue NAIS Infiltration [Medium-Hard]: Continuing prior efforts to infiltrate the New Avalon Institute of Science is vital if we want access to their latest designs and most secure production sites.
    With the prior quarter's efforts to penetrate the Federated Suns' most sensitive areas succeeding without a hint of discovery, the year's final quarter saw Helghan's intelligence services double down on the decision; orders sent out to the myriad agents, catspaws, and no-goodniks operating in the region to make for New Avalon's Institute of Science. Boasting a lengthy history able to stand up to any scrutiny and aided by the heavily veiled spies already burrowed into the NAIS, a quintet of agents put their all into inserting assets into the top secret organisation's closely guarded research division, their domesticated scientists fed theory after theory and gifted (minor) breakthrough after (minor) breakthrough. Doing everything short of jumping up and down and waving their arms at the NAIS' recruitment division, these captive researchers—unaware of the true nature of their benefactor—published paper after paper for the Republic, the days turning to weeks and the weeks turning, in time, to months.

    Alas, all these efforts soon proved for nought as the new year came and went; the surge of papers and brilliant new theories released into the wild unable to interest an organisation typically hungry for intellectual resources. Burned by the Republic's prior infiltration successes—though seemingly unaware of the Republic's role in said infiltrations—the Federated Suns has grown more protective of its one remaining gem than ever before, the intelligence cordon placed upon the NAIS the strongest it has ever been according to Helghan's spies. Fortunately for all involved, this increased protectiveness has not translated into Federated Suns' counter-intelligence agents gaining magical capabilities or preternatural competence, and no sign of detection has been uncovered by Republic agents embedded in either the government or palace networks. Undeterred by their quiet failure, the lack of discovery proving a heady wine, officials within Republic security services have understandably begun to push the Gemini government towards continuing the attempts.

    Effect
    • Attempt fails with helghan spies unable to penetrate any further into the organisation
    • No indication that the FedSuns have noticed the attempt, though

    [X] Deploy Spy Ships: Though not as effective as they would be within, say, the Federated Suns, deploying Hyde-class surveillance vessels to Clan-held regions will improve the ORDI's ability to gather information substantially.
    Keen to repeat last quarter's success and with Operation Santiago's headquarters ever hungry for information on the Clans' activities and whereabouts, early October saw a slate of spy ships ordered to deploy into the wartorn coreward expanse; fifteen Hyde Class Surveillance vessels swiftly brought to the area of operations under the guise of secondary supply ships. Tended to by ever-vigilant crews and kept supplied by the constant stream of transports passing them by, the spycraft arrived in the region a mere two months after their deployment orders were writ and immediately set out for their destinations deep within Clan-held territory, their departure unremarked upon thanks to the cooperation of the Free Republic's space monitoring personnel. Carefully monitoring their progress from Skandia, headquarters' personnel watched with bated breath as ship after ship committed to the final plunge into their target system; days old messages dispatched by black box carrying final status updates before the crews warped their vessels into the frozen outer reaches of more than a dozen hostile systems. Mere hours later—a delay the more experienced staff knew was just long enough for Hyde's to deploy their surveillance gear from their recessed protective cavities and scan their local environment—all clear messages arrived from all the systems targeted. All, that was, except one.

    According to the terse message broadcast by the HNS Fisher King before being scuttled, the would-be spy vessel had the astronomically poor fortune of arriving within five million kilometres of a Clan dropship, the Union-C halfway to a nearby trojan cluster when it entered the system. No doubt patrolling the system for stealth satellites, the Clan drop ship immediately detected the radiation pulse released by the Fisher King's warp drive and burned hard for the spycraft; the crew aboard elected to suffer bruises and other ailments from the sustained multi-G acceleration in the hopes of catching a supremely elusive prey. Following their training, the Fisher King immediately began preparations to evacuate the system only to have the delicate internals of the ship's warp drive quench catastrophically due to the rapid cycling of the FTL engine—the resulting explosion cracking one of its three fusion drives and damaging another. Finding his proud craft wounded and its engines only able to achieve a single gravity's worth of thrust, the Fisher King's captain ordered the vessel to flee from its pursuers and his crew to prepare for boarding; scuttling charges prepared throughout the ship, sensitive items and documents destroyed, and lifeboats prepped.

    Twelve hours later, its black box having faithfully reported the launch of escape pods, the Fisher King went up in a flash of light as scuttling charges ruptured its fusion engine and allowed the raging sun inside to consume the vessel whole; the Union-C having long ago given up the chase in favour of the lifeboats it left behind.

    Effect
    • Attempt to deploy spy ships sees most go well… but one finds a Clan dropship patrolling close enough to its emergence point that its arrival is detected.
    • Attempts to shake off the dropship fail, but crew prove able to torch everything sensitive before evacuating the craft and activating scuttling charges. Crew now in Clan custody, but at least the info isn't.

    [X] Establish a continuing effort to provide propaganda relating to the Clan war effort (lock 1 AP to propaganda)
    In contrast to earlier efforts, the October-December period saw a marked improvement in the attitude of Helghan citizens towards Operation Santiago; a revamped media campaign, fresh eyes added behind the scenes, and a spate of victories by Inner Sphere nations conspiring to bring about substantial change in the zeitgeist. Sourced from all over the recaptured systems, stories of liberation, aid, and gratitude filled the airwaves throughout the nation and appeared in newspapers and on posters. A profound divergence from the previous go-tos of terror, hardship, and brutality, the addition of such feel-good stories proved to be exactly the change needed by the program. Previously declining month by month before slowing thanks to the heroic efforts made last quarter, the changes instituted by those overseeing the AgitProp program and the acquisition of new stories proved well worth their cost in Marks and sweat, the hardening of popular sentiment petering out as memories of the Clans' earlier successes faded, and attention turned to the recent string of hard-earned victories.

    Though still fragile, the renewal of interest in Operation Santiago—or, more accurately, the decline in disinterest—has nonetheless been taken as a sign by Republic politicians that the nation still has some fight left in it. Moreover, the end-of-quarter sentiment analysis conducted by the AgitProp program no longer speaks of a complete collapse in the popular will should the Clans prove reinvigorated and renew their assault; predictions by the best analysts the Helghan government can afford determining that it would merely be catastrophic. A minuscule but distinct difference, Helghan politicians and military figures alike have grasped the improvement like a lifeline, 3050's final weeks seeing a quiet increase made to the program's budget.

    Effect
    • AgitProp uptake is a little better this quarter in large part due to the successes of other IS powers and refinement of message. Not amazing, just enough to keep public support from dropping this quarter.

    [X] Lothan Factory Complex Construction: As expensive as it will be, constructing a factory complex on Lothan will provide ORDI forces with an additional source of spare parts. [Progress: 2/10] [Locked Until Completed] [+1 AP from Capellan Confederation]
    Continuing from last quarter with no loss of momentum, Q4 saw Republic engineering teams throw themselves into the task of constructing Lothan's would-be factory megaplex; the legion of automata and workers brought over last quarter reinforced on an almost daily basis as more and more transports made the 1000-plus lightyear journey. Well-versed in the plan during the lengthy journey to Lothan and well-prepped besides, these workers streamed from the holds of their transports, immediately joining their Rasalhaugian counterparts in clearing the surrounding terrain and expanding the already extensive foundations. Though colossal by any reasonable metric, the ferrocrete plug sunk into Lothan's loamy surface to serve as the factory's foundations was nonetheless insufficient for the goal Helghan's leaders had in mind, October seeing the grey slab steadily expand as workers laid down plug after plug beside it; satellites in orbit witnessing the factory's footprint expand like a months-long oil spill.

    Completed by the twilight of November, the final foundation proved a construct without equal on Lothan; entire city blocks could fit comfortably on the ferrocrete surface with room to spare. Rapidly curing by design, the year's remaining weeks saw the present labourers shift gear towards more complex, but not particularly more delicate work, the skeletons of buildings erupting across the slate-grey ferrocrete and reaching for heaven. Constructed out of prefabricated modular components manufactured across the Free Republic, the building frameworks arrived at the planet's spaceport in their hundreds and were shipped out via the purpose-built highway in equal numbers; so many trucks required to move the materials that—some soon joked—one could walk from the spaceport to the factory without ever touching the ground, the river of trailers all one needed. Despite the ease of assembling the buildings, however, the year's final days saw the planned completion date remain frustratingly out of reach, a mere quarter of the assembly halls and warehouses raised as December gave way to January.
    [Progress: 2/10] → [Progress: 4/10]

    Effect
    • Solid progress.

    [X] Operation Santiago Phase 8:
    -[X] Firstly, continue reinforcing the line of defense as per last turn, preparing planets for apocalyptic fighting.
    -[X] Second, greenlight deployment and transfer of a significant portion of Helghan's nuclear arsenal, reserved for use against the Clans' blackwater fleet only, in systems likely to face heavy assault.
    -[X] Third, use the remaining Ground Capacity (about enough to support a brigade) and request the deployment of the Canopian and Capellans' cybernetic special forces divisions for a trial by fire.
    -[X] Fourth, continue to sponsor the Dragoons' raiding activities as before and utilize our fleet to target JumpShip convoys carrying Clanner resupply and reinforcement, using spycraft and assets to maximize the results of both activities.
    -[X] Finally, offer once again to the Lyran Commonwealth the partial deployment of the First Army (1-2 Divisions) to man the defenses they are currently building (and to make use of the Helghan Corps of Engineers accompanying them for the same) in exchange for supply lines for them, as well as additional MAWLRs if they can manage them. In addition, offer the Guided Missile Cruisers back to the table again in the terms of the lend-lease agreement, this time without the expectation of tech-sharing. They've virtually guaranteed that they're going to be hammered hard, and this may be their last chance to obtain either of these things with their supply lines still intact.
    With the psychological pressure of the inevitable return of Clan offences bearing down on them, the year's final quarter brought further orders to Operation Santiago's command to dig in as deep and extensively as possible. A sentiment shared by Commodore Ostergaard himself—Clan prisoners chiming in in support—the orders found fertile soil among the international operation's leadership and backers, all agreeing that the present was the perfect time to entrench. Already building fortifications thanks to last quarter's change towards a defensive posture, October's first weeks saw ORDI engineering divisions and ground troops alike discover their workloads increased as ever more structures were added to their todo lists, hidden airfields, armoured supply depots, and discrete landing zones just some of the many works they were to complete before the new year.

    Ill-contented by this conventional response posed by the Clan threat, a small but influential group of Republic politicians simultaneously moved to strengthen the already potent power of the ORDI fleet in the region. Meeting with Gemini Malkiewicz and several members of their government and the Republic's military, these politicians quietly made a case for the deployment of nuclear arms among Helghan Navy vessels, "Never Another New Bergen" becoming a watchword among them as they argued for the use of nuclear arms to devastate Clan warships. Convinced by their arguments and wary of the damage such warships could do to defensive efforts, not to mention public morale, these meetings soon bore fruit; October 11th the day the Prime Minister okayed the deployment of several dozen nuclear devices. Bare days later, a handful of boring freighters with boring cargo manifests and distinctly not-boring security contingents departed Helghan's Supra Memnonia space elevator for the frontlines, countless eyes tracking them at every step of their months-long journey.

    However, despite the undoubtedly crushing anxiety afflicting its decision-makers at the thought of so many nuclear weapons traversing the Inner Sphere in secret, the Republic government was not idle in mid-October.

    Eyeing its allies' cybernetic troop programs with no small amount of envy and eager to secure Operation Santiago every advantage it could get, the Helghan government reached out to its allies in the hopes of getting the Capellan Sardau—supposedly named for their secretive training grounds—and the Canopian Keres dispatched corewards. Fortunately for the Republic, which had been spending great sums of political influence over the past few months, these requests met with receptive audiences in both nations, their leaders proving inclined to support the joint military operation with some conditions. Expensive to develop in the first place and composed of the most elite troops in either nation, the Magistracy and Confederation alike made clear that they would not part with the Keres and Sardau if they were to be thrown into combat unthinkingly; both instead demanding that their special forces units covertly damage and disrupt Clan holdings in captured systems. Already inclined to agree to what they viewed as eminently reasonable conditions, Prime Minister Malkiewicz found their views further strengthened by support from Commodore Ostergaard, the man valuing the disruption they could cause Clan activities over any straight combat power they could provide, and agreed to the conditions presented.

    However, even as these cybernetic soldiers began to make their way to join Operation Santiago, Jamie Wolf's Dragoons were already making life miserable for those Clan Wolf warriors who had the misfortune of being in jump range.

    Well-equipped with Clan mechs and weapons thanks to last quarter's highly successful duels and supported with a seemingly infinite supply of ammunition and spare parts courtesy of the ORDI, Q4 3050 saw Dragoon raiding parties strike out from Valdis (also known as Wheel), Hyperion, and Thun against their Clan opposites; more than half a dozen units setting forth to do battle. Led by the inestimable Jamie Wolf and Natasha Kerensky, these forces fell upon the Wolf clusters across the anti-spinward front like their namesake, fearsome battles raging as brother fought brother in furious duels for warriors, equipment, and honour. Unfortunately for those hoping for a repeat of past days, the defending wolves proved more than ready to meet their Dragoon opponents in the year's final quarter, the Dragoon raiders winning only four out of seven engagements and only barely in two cases. Badly battered by December's close, the Dragoons nonetheless appear to have taken the bruising well, the bullheaded mercenaries and their belligerent commanders promising a return to form next year.

    Likewise, attempts to raid Clan supply convoys and JumpShips met with only middling results despite Ostergaard's expertise in organising them and the information gleaned via spy satellites and Hyde class surveillance vessels. Initially starting strong with two convoys hit for no casualties, early November saw Clan jamming increase in coverage across the front and capability in general; black box enabled communications degrading as the jamming increased. No doubt the result of Clan scientists examining those spy satellites previously intercepted and reverse-engineering the messaging components—if they didn't already have the technology—the ensuing disruption resulted in a degraded ability to intercept convoys; several examples of ORDI warships arriving at a destination only to find their targets long since gone occurring over the quarter. Making matters worse, a pair of Capellan Carson II-class frigates acting on fresh intelligence arrived at the planned interception site only to find that not only was the expected convoy not there but that it had never been there—an investigation of the surrounding space uncovering a satellite of Clan manufacture containing ECM gear used to spoof the presence of a JumpShip convoy.

    Though dampened by the string of failed convoy interceptions, Commodore Ostergaard's spirits were buoyed in late November when, after extensive negotiations with the Lyran Commonwealth, the state finally agreed to host a pair of Helghan divisions and accept a pair of Toxotai. Offered in the spirit of fraternal camaraderie—but primarily due to fears that the LCAF had dangerously overreached in its recent counter-attack—the First Army's Fifth and Sixth Divisions and the twin ships Victory and Constitution were hurried along the ORDI's command circuit and arrived in mid-December; the twenty-thousand or so troops garrisoned across the score of recently recaptured systems. Quite to the surprise of both the LCAF and Operation Santiago's command staff, the reaction of Lyran civilians to the sudden arrival of Helghan troops has been broadly positive. While naturally holding some reservations towards them—reservations at least partly engendered by the presence of Helghan villains in the recent releases of several popular film series—Lyran citizens have, on the whole, chosen to view the deployment of so many foreign troops in a positive light. How long such a view will last remains to be seen, but ORDI figures have thus far chosen to stay positive lest they create the future they fear.

    Effect
    • ORDI forces continue to entrench throughout the region.
    • A solid chunk of Helghan's nuclear arsenal is deployed to the frontlines for use against naval assets.
    • ORDI allies agree to deploy spec ops forces, but only under the condition that they be used off the frontline. Good enough.
    • Dragon raiding is mixed. Win 4 out of 7 raids and take some supplies, but mostly just disrupted Wolf formations rather than loot much.
    • Anti shipping raids prove middling despite the degree of spyware deployed. Some jumpships were destroyed, but a number of convoys either evaded or simply weren't where they were expected. Looks like the clans are getting better at hiding their movements.
    • The Lyrans agree to provide enough support for 2 divisions without even requesting a treaty or anything be signed. Amazingly, the Lyran people are happy about foreign troops deploying on their streets and are quite welcoming. Lyrans also accept the Toxotai, but this puts the Helghan supply route for critical parts there at its limit.

    Design and Requisition
    [X] Flechette Charges: Designed by the Helghan Defence Corporation out of Bloemfontein, Flechette Charges are little more than directional command-detonated anti-personnel landmines attachable to the outer armour of a Battle Armour suit. Inspired, on the one hand, by the Anti-Personnel Pod's seen on Clan mechs and, on the other, the needle weapons so prevalent throughout the Inner Sphere, flechette charges send out a spray of explosively formed polymer-composite flechettes able to shred flesh and penetrate some light armours upon detonation. Intended for use in close-quarters combat or to clear the area below a leaping BA unit, flechette charges are one-time-use items but offer little to no additional risk.

    [X] BA Spider Mine Dispenser: Essentially a scaled-down version of the mine dispensers used by Republic forces to deploy spider mines around secure areas, the BA Spider Mine Dispenser is securely attached to the back of a Battle Armour suit and allows its user to deploy more than a dozen mines on the battlefield at the click of a button. Easily reloaded via specially made cartridges and featuring a quick-release system for use if reload is unavailable or the backpack itself becomes a hazard, the BA Spider Mine Dispenser is a valuable bit of equipment for any Battle Armour squad.

    [X] BA-scale Irradiated Petrusite Projector: A midway point between the infantry and mech version of the IP Projector, the Battle Armour-scale IP Projector is a short-range but incredibly deadly weapon able to pose a threat to mechs and their pilots… as well as infantry squads hunkered down in cover.


    News and Rumours

    Helghan
    Coming as a surprise, a review of refugee numbers in the new year saw the number of refugees arriving in the Periphery decline somewhat compared to last quarter, with only 1.5 million more people entering ORDI space. Undoubtedly a result of the yearlong pause in Clan hostilities, the slight reduction has come as a relief to those systems between the frontlines and the Periphery; the refugee situation is far more critical than there within the ORDI.

    Predicted Refugee Acceptance Breakdown For 3050 (+-5%)
    Helghan Republic:     27,410,000
    Aurigan Coalition: 2,525,000
    Capellan Confederation: 12,300,000
    Magistracy of Canopus: 5,740,000
    Taurian Concordat: 4,075,000

    Having stolen up on the Helghan Republic's ruling party thanks to the distraction of the Clan Invasion and the resulting scramble to organise a response, December 31st, 3050, saw the Helghan government enter its final year of rule before another national election. Having come to power during a special election in late 3047 following a no-confidence vote against the then-ruling party, Prime Minister Malkiewicz now finds themself left with the choice of whether to call the election early, hold it at its usual time between quarters two and three, or wait until the end of the year when various laws would compel them to hold it. Wildly successful in their efforts to free the people of the Outback from misrule by the Federated Suns, responsible for a vast increase in prosperity within the Helghan Republic, and having strengthened the Republic's alliance with its neighbours, Gemini Malkiewicz and their government enjoys broad support domestically and internationally and would ordinarily be considered a shoo-in for reelection. However, despite these successes and others, the Gemini government's repeated interventions in the Inner Sphere and the growing exhaustion of Helghan citizens towards the wars have left some wondering if a more dovish platform might prove more popular with the public.


    As per the promises made in late August, the year's final quarter saw a series of referendums held across the former Trinity League to decide the ultimate fate of the systems there, millions turning out to vote in the first democratic movement seen in the region in countless years. The recipients of substantial support from the Helghan Republic, public attitudes toward Helghan ranged from merely positive to more patriotic than Helghan patriots, the only real question on commentators' lips being whether those positive feelings would translate to support for joining the Republic or if independence would win out. Prepared over three months and carried out in a mere week, the referendums on joining the Republic proved difficult, nerve wracking, and ultimately successful for Helghan, every single system in the region voting to join the Republic as member-states in a complete vindication of the Malkiewicz government's actions.

    Greeted with celebration throughout Helghan space and the former Trinity League, the addition of so many backwater systems has nonetheless generated some concern within the Helghan civil service. Backwaters before the Capellan deserters arrived and only somewhat developed in the years between their takeover and Operation Telemachus, the half-dozen systems now represent an unprecedented drain on the Republic's coffers and a potential distraction during a critical time. Though the recently begun System Upgrade Program will undoubtedly shoulder the burden, the sheer number of planets and people added to the Republic may require additional expenditures so as to avoid a similar situation to what's currently occurring in the Taurian Concrdat's newly integrated regions.


    Aurigan Coalition
    In positive news from the Aurigan Coalition, the crew aboard the Wa'a Kaulua have reportedly completed the first 250-light year leg of their journey across the Outer Rim Defence initiative—the purpose-built long-range exploration vessel making good time despite the occasional layover to allow civilian astronomers time to image the craft. Gaining fans with every Taurian system visited and every interview held, the 200,000-ton explorer and its four hundred or so crewmembers have experienced few difficulties on their journey; every system aboard the craft working according to spec. Though expected to continue for a few dozen light years more next quarter, March 3051 will see the vessel well on its way to the Canopian fringe, that leg of the journey eagerly anticipated by Canopian (and Helghan) spaceflight enthusiasts.


    Continuing earlier efforts to draw Herotitus into its warm embrace, Q4 3050 saw the Aurigan Coalition extend generous developmental loans to the nearby system; millions of C-Bills handed over to the planetary government under some quite generous terms. Designed to build up multiple areas of Herotitus' society, the loans feature low interest rates and few stipulations beyond the requirement to have a plaque thanking the Coalition on any structure built with the funds. A charitable gift by any measure, the move has brought the Coalition great popularity with the planetary government and population, and a sharp uptick in public sentiment has been noted by Helghan analysts. Done to increase the system's value and make the thought of union with the Coalition more palatable to even the most staunchly independent-minded inhabitant, it seems only a matter of time until the Republic's ally absorbed one of the region's few remaining independent governments.


    Capellan Confederation
    As expected by observers from across the Inner Sphere, late December bore witness to the opening of two additional 1,000,000-ton capacity slipways in the Capellan Confederation; the honeycomb structures are the product of countless millions of person-hours of labour by humans and machines alike. Opened to much fanfare by one of Tormano Liao's top deputies, the launch of the orbital slipways brings the total number in the Capellan Confederation to four, 33% more than what the Helghan Republic can boast. Unsurprisingly, within days of the slipways being opened, they were immediately put to work constructing another pair of Fenghuang class Cruisers for the ever-growing Capellan Navy, their estimated completion date hovering around June-July 3053.


    In a move that is no doubt the culmination of many months of quiet negotiation between the Capellan Confederation and the Magistracy of Canopus, mid-November saw a joint announcement by the states informing their allies that they have signed a deal that will see Capellan tertiary educators provide long-term assistance to universities throughout the Magistracy. Having established many new universities in recent years to satisfy local demand and increase the general education level of her citizens, Magestrix Emma Centrella has spent vast amounts of effort and even more money seeking personnel to staff them. While Helghan has naturally proven her first port of call time and again and has provided many educators over the years, teachers from the Aurigan Coalition, Taurian Concordat, and even the Free Worlds League have been enticed to make the journey—permanently or otherwise. With the signing of the deal between the Capellan Confederation and the Magistracy of Canopus, it seems the Magistracy's education needs have been met for the foreseeable future, though it remains an open question if it will stay that way for long.


    Magistracy of Canopus
    Speaking of the Magistracy of Canopus, late 3050 saw a further six Canopus-class frigates launched from Canopian slipways; the half-dozen vessels brought the total number of Canopus class to eighteen and the total warship count of the Canopian Navy to twenty-four. Commanded by an increasingly capable officer corps and crewed by extremely well-educated enlisted personnel, the reputation of the Canopian Navy has grown by leaps and bounds over a mere handful of years, and their dress uniforms remain the envy of the galaxy despite what some Helghan personnel have claimed. Expected to continue investing in their navy given warships' obvious utility as warfighting and anti-piracy platforms, many within the ORDI look forward to the day Canopian vessels form a major component in ORDI task forces.


    To the delight of fans of gladiatorial mech games throughout the galaxy— and Helghan fans, in particular—December 3050 saw Hardcore's yearly mech games won by Helghan native Constantin Riber. The second-place finisher of last year's games, Constantin piloted his mech, a 90-ton Highlander affectionately known as the Rusalka, to victory despite fierce competition by rival Bunny Giménez and a relative newcomer to the scene, the Capellan Dimka Ruan. The winner of Hardcore's 3049 games, Giménez was the crowd favourite to win the 3050 tournament but found Constantine and Dimka far more challenging to overcome than initially anticipated and placed third out of the three. Meanwhile, former third-place finisher Aubrianna Stone retired early from the games to serve in the Magistracy Armed Forces, and filtered propaganda footage of her unit in action has proven popular across the Magistracy, the MAF earning substantial financial support from the public.

    Claiming the championship cup for his home stable, the Chimera Commandos, Constantin Riber will undoubtedly return next year to defend his victory and retain the trophy; Bunny Giménez and the newly-famous Dimka Ruan are certain to return as well.


    In more scientifically minded news, late 3050 saw researchers in the Magistracy of Canopus unveil a technological breakthrough many years in the making, geneticists there having perfected the process of creating targeted gene plagues. A game changer for nations seeking to colonise planets with forms of life that are notably hostile to human biology—be they disease-causing microorganisms or man-eating plants—the Canopian gene plagues are capable of wiping out entire species with little to no blowback on more desirable forms of life. The organic equivalent of smart bombs, these precision biological weapons can reportedly be made so exacting in their targeting that the scientists responsible for their development have begun claiming that a Terran house cat could inhale a virus intended for European wildcats and not be infected—a bold claim from sources notorious for their conservatism when it comes to such things.

    Seeking to showcase the effectiveness of their tool as a terraforming agent, the scientists responsible assembled a demonstration in which they exposed various life forms from Appian to virii engineered to seek out and destroy the recently identified brain-eating protozoa that has been the cause of so much misery on the planet. In just a few hours, much to the shock of the scientists' counterparts across the Periphery, 100% of the targeted protozoa had been killed by the virus, while all other life forms showed no sign of ever having been exposed. A joint venture between ORDI states, the research has already been shared with Canopus' allies, and many have begun to wonder when they can expect the colonisation of Appian to start and by who.


    Taurian Concordat
    In a surprise move by the Taurian Concordat, it appears that the militantly defensive nation has bowed to growing pressure in its recently absorbed coreward expanse, the Calderon government announcing a temporary pause on all new constructions for an unspecified length of time. Viewed as an unnecessary expense by many of the Concordat's newest citizens, the Taurian shipbuilding program had been the target of increasingly pointed criticism by an angered populace and a vulnerable point for the newly inaugurated Edward Calderon. While this pause on new ship constructions has not reached the nation's expansion of shipbuilding facilities—three more 500kt slipways opened in December—many within the Concordat are hopeful that the funds freed up will help expand rights and services in the nation's new backwater and the newly absorbed systems established by the Far-Lookers.


    As if that wasn't sign enough of the seriousness with which the Concordat is taking complaints from the coreward reaches, December 3050 saw Edge Industries and Taurus Territorial Industries unveil a jointly designed hospital ship to a surprised public; the turn to medical shipbuilding very unexpected considering the history of both corporations as arms manufacturers. The brainchild of TTI CEO Brett Lambert, a close friend of Protector Calderon and Dr Eoin, the Nightingale class is a 150,000-ton warp-capable hospital ship intended to support frontier solar systems suffering from an acute lack of medical care, the aftermath of a natural disaster, or civil conflict. Able to provide top-of-the-line medical care thanks to the state-of-the-art medical technologies aboard and the ease of reconfiguring the vessel's loadout, the first Nightingale will launch sometime in the next three to four months and begin providing medical care shortly after.


    With the habitat's outer shell completed late last quarter, the October-December period saw Far-Lookers in the Burton system begin to fill the cylindrical megastructure with soil, water, and air: a slew of asteroids positioned in advance descended upon by hungry mining craft that attached themselves like limpets to their icy surfaces. Though small by the heady standards of the O'Neill Cylinder's inventor, Gerard K. O'Neill, the Burton cylinder will require nearly 600,000,000 tons of soil, 260,000,000 tons of air, and many times that amount of water before it is complete. Though water and air are easy to acquire even in space's barren expanse—the substances both recoverable from the water ice covering the collected asteroids—the needed quantity of soil can only be provided by asteroid regolith, chemical plants and genetically engineered bacteria converting the waste product of ice and air harvesting into bioactive material. Expected to last many times longer than the cylinder's construction phase, making it habitable for human life will undoubtedly prove an absorbing challenge for the Far-Lookers, and its realisation will prove a fantastic feather in the cap of the Taurian Concordat.


    United Rimward Collective
    Once again proving the adage that no good deed is ever left unpunished, Q4 3050 saw the situation in the United Rimwards Collective continue to devolve as tensions between the Neo-Jacobnists and Maoist-Gaullists rose precipitously. Fellow travellers during the Outback crisis only in so much as they both wished to do away with Federated Suns' nobility, the Neo-Jacobinists' recent moves against URC Marxists and the Jacobinists' accusations of malfeasance against the Maoists have resulted in increasingly violent confrontations between supporters of the two groups despite the presence of Helghan peacekeepers across the nation's territory. Though not quite so bad as the situation between the Marxists and Neo-Jacobinists—the latter having successfully driven most of the former underground and the rest to the capital of Firgrove—battle lines are already being drawn between the Jacobins, whose support base primarily resides in the nation's urban regions, and the Maoists, whose supporters are largely rural. Though what the future may hold for the region remains unclear, many within the Republic worry that the power struggle between the nation's three major factions may devolve into open conflict should the worst come to pass.


    Clan Invasion (Varied)
    It began just as it began the last time, Kerensky's Children surging forth over previously static frontlines as they sought to overwhelm the Inner Sphere's defenders with their advanced technology and superior MechWarriors—warships laden with dropships arriving in two dozen solar systems in the blink of an eye. Striking forth in mid-December with the same aggression they've displayed throughout the invasion, Clan forces all but threw themselves at their foe across a front half as wide as the Inner Sphere itself, a year of rest seeing their vitality restored despite the bitter fighting that preceded it. Alerted to their arrival by the telltale flash of hyperspace travel, troops on a score of worlds found themselves rousted from their beds or pulled away from their labours by wailing sirens and blaring radios.

    This time, however, the attack did not come out of the darkness of the wider galaxy, nor did its preparations go unnoticed by the nations of the Inner Sphere and Periphery. On Clan-held planets, hidden within restless populations cowed by the threat of force or cloaked in the depths of space, local guerrillas, spy satellites, and surveillance vessels reported the inevitable troop buildup despite the Clans' jamming efforts, images and sensor readings dribbling in across the occupied territories. Gifted to Spheroid governments and their rimward allies, this information—and a year's worth of fortification efforts—bought defenders precious time to prepare for the onslaught, a line of fortifications unsurpassed since the days of the Star League constructed on worlds as far apart as Baebeski and Echo, and troops placed on alert mere weeks before the invasion resumed.

    Stationed in the Free Rasalhague Republic, ORDI troops and their commanders could only watch in mounting frustration as the long-anticipated Clan Invasion began once more with thrusts on either side of the heavily defended Free Republic, news channels bursting to life with reports of Clan warships spotted in the Lyran Commonwealth and Draconis Combine. In under two weeks, despite fierce resistance from the defenders and a bloody toll reaped by their defences, Clan forces seized control of two dozen Lyran and Draconis worlds before the New Year; the overwhelming number of warriors deployed against the defenders safeguarded from interception by yet more invader warships. Only in Shaula and Altenmarkt did the Clans dare show their faces against the ORDI, the former an attempted raid by Clan Wolf torn to shreds by the ORDI-Dragoon defenders, and the latter seeing a Clan Snow Raven Essex II jump in and wait for ORDI warships to make preparations to warp to the sun, before jumping out without ever engaging; the captains of the vessels electing not to follow for fear of being caught out of position.

    However, despite not facing the fury of the renewed Clan assault, ORDI intelligence assets located throughout Clan-held systems and the increasingly communicative nature of Inner Sphere states soon provided Commodore Ostergaard and his superiors with several unpleasant revelations.

    The first, and perhaps least surprising, discovery was that of the presence of several new Clans present in the conflict: analysis of hastily snapped pictures, dimly remembered logos, and overheard battle cries revealing that Clans Ghost Bear, Goliath Scorpion, and Steel Viper have joined the invasion; the first two attacking the Lyran Commonwealth, and the latter striking out against the Draconis Combine. The second revelation, meanwhile, was of Clan warship groups gathering at two distinct locations corewards of the frontline, analysis by military intelligence personnel suggesting that at least twelve warships of varying classes are busy mustering near Trell and at least thirty are mustering near Pomme De Terre. Finally, and perhaps the most bitter revelation, was the discovery of Clan warships equipped with Petrusite-based energy shielding—long-range surveillance footage taken by ORDI stay behind troops showing a McKenna class battleship surrounded by a telltale halo of blue light. Though doubtlessly primitive compared to modern energy shielding systems, the mere existence of Clan energy shielding is concerning for obvious reasons.


    Federated Suns
    Coming as a surprise to only those who have been living under a rock for the past half-decade, December 3050 played host to a slew of launch ceremonies in the Federated Suns: four Reynard Destroyers, two Chevalier Frigates, and two of the newly-named Reeve class leaving FedSun slipways with a few weeks of one another, and four 200-kt slipways converted into their 500-kt siblings.

    According to the design notes intercepted by Helghan spies, the Reeve class is a 500-kiloton warship intended to combat certain unnamed rimward powers who utilise a preponderance of small craft in their naval doctrine. Featuring ten docking collars—the most a craft its size can boast—thirty-nine sub-capital lasers, over a hundred laser anti-missile systems, seventy medium lasers, and just enough BPL launchers to threaten a capital ship, the Reeve is clearly designed to support other AFFS warships in operations against the Outer Rim Defence Initiative. Though not a particularly threatening craft, the Reeve can effectively defend itself and its charges against sub-capital threats thanks to its armament and speed while delivering a bloody nose to any capital vessel that thinks it is easy pickings.

    Code: 
    Class/Model/Name:    Reeve
Mass:    500000 tons

Equipment                                                 Mass
Engine:    Fusion Engine                                  120000
Safe Thrust:    4
Maximum Thrust:    6
Structural Integrity:    180                              90000
Total Heat Sinks:    1125 Double [2250]                   591
Bridge, Controls, Radar, Computer & Attitude Thrusters    1250
Fire Control Computers                                    850.5
Food & Water (180 days supply)                            191
Spare Parts (1 percent)                                   5000
Fuel & Fuel Pumps (50000 Points)                          20400
Kearny-Fuchida Hyperdrive Compact (12 Integrity)          226250
Armor:    Standard (828 total armor pts)                  1800

                      Capital Scale Armor
Front                 163
Fore-Left/Right       133/133
Aft-Left/Right        133/133
Aft                   133

Bays and Cargo:   
  Bay 1:    Cargo Bay (Standard) with 2 doors             1335.5
Dropship Capacity:    10                                  10000
Life Boats:    36                                         0
Crew:   
36      Officers (25 minimum)                             360
109      Crew (100 minimum)                               763
67      Gunners (6 minimum)                               469


     Weapons & Equipment    Loc      SRV      MRV      LRV      ERV      Heat      Mass
4    SCL/1                  Nose     4(40)    4(40)    4(40)    0(0)     96        600
14   Laser AMS              Nose     0(0)     0(0)     0(0)     0(0)     98        21
10   H-Medium Laser         Nose     5(50)    5(50)    5(50)    0(0)     30        10
5    SCL/1                  FL/R     5(50)    5(50)    5(50)    0(0)     240       1500
14   Laser AMS              FL/R     0(0)     0(0)     0(0)     0(0)     196       42
4    Killer Whale (60 rnds.)FL/R     16(160)  16(160)  16(160)  16(160)  160       7200
10   H-Medium Laser         FL/R     5(50)    5(50)    5(50     0(0)     60        20
5    SCL/1                  L/RBS    5(50)    5(50)    5(50)    0(0)     240       1500
14   Laser AMS              L/RBS    0(0)     0(0)     0(0)     0(0)     196       42
4    Killer Whale (60 rnds.)L/RBS    16(160)  16(160)  16(160)  16(160)  160       7200
8    H-Medium Laser         L/RBS    4(40)    4(40)    4(40)    0(0)     48        16
5    SCL/1                  AL/R     5(50)    5(50)    5(50)    0(0)     240       1500
14   Laser AMS              AL/R     0(0)     0(0)     0(0)     0(0)     196       42
8    H-Medium Laser         AL/R     4(40)    4(40)    4(40)    0(0)     48        16
5    SCL/1                  Aft      5(50)    5(50)    5(50)    0(0)     120       750
14   Laser AMS              Aft      0(0)     0(0)     0(0)     0(0)     98        21
8    H-Medium Laser         Aft      4(40)    4(40     4(40)    0(0)     24        8
                           
    TOTALS:                          78       78       78       32       2250      20488

    Worse still, at least from the point of view of Helghan warship captains, the same spies that delivered the Reeve's design notes have also uncovered evidence that FedSun engineers have devised a swath of new assault dropships for the explicit purpose of combating the Republic's small craft advantage. While details on the designs are lacking, unguarded comments made in earshot of ORDI spies indicate that these new dropships can outpace many aerospace designs in ORDI arsenals; an astonishing claim if proven true.


    Free Worlds League
    Likewise, the October-December period saw the Free Worlds League welcome four additional valour class warships into the ranks of its navy; the quarter of vessels reportedly suffered some minor issues during their shakedown cruise, but otherwise turned out well. Meanwhile, the same period saw League workers complete construction work on four 500,000-ton slipways across the nation's industrialised interior, reports from what few assets the Republic holds in the region suggesting that the League has started a staggered build program that will see six warships delivered every three months.


    In substantially more interesting news than the Inner Sphere's continued naval buildup, the tail end of the year saw the comparatively well-liked Captain-General Thomas Marik take advantage of his reputation and political influence to deliver a coup to the Free World League Military. After a tough season of campaigning that featured many a public dinner and doubtlessly many more private ones, the latest leader of the Free Worlds League held a press conference in the nation's capital announcing the final abolishment of the Home Defense Act that had so hamstrung the FWLM's ability to prosecute a war in years past. Already reduced from its height thanks to an inconclusive 5th Succession War, the ever-encroaching forces of the Clans appear to have been the final shove needed to tip support for abolishing the act over the line, with League news sources indicating that vote for abolishment was split 60:40—an impressive showing for the Captain-General!

    The product of many years of work by Thomas Mariks and those Mariks that came before him, the final dismemberment of the act has freed up a great many regional regiments for service in the nation's military; complaints against the move understandably quiet given the recent resumption of hostilities. Already a superior fighting force to what it had been only a few decades ago, the end of the Home Defence Act will turbocharge the military's ongoing restructuring—funded by arms sales across the galaxy—and improve the nation's ability to fend off the Clans should they somehow make past Terra.


    Lyran Commonwealth
    Much to the relief of those watching the Clan's progress with worry, the end of the year saw the Lyran Commonwealth launch four more Thor-class frigates to join the twelve already present; all sixteen cast towards the onrushing Clans. Simultaneously, the end of December saw work on four additional 500,000-ton slipways completed by Lyran workers, Tharkad, Donegal, Tetersen, and Eutin boasting three slipways each. Almost certainly going to prove vital in efforts to slow the Clans' advance, newly released propaganda pieces from the Commonwealth have reported a massive expansion of the nation's planned navy; construction on a slew of vessels reported.


    Speaking of: the sudden restart of the Clan Invasion was met with a massive propaganda campaign by the Lyran Commonwealth—posters, flyers, radio programs, TV advertisements, pre-movie newsreels, speeches from the Archon, and a dozen other mechanisms exhorting the Lyran people into resisting the Clanners.

    Painted, not unfairly, as fascistic eugenicists who seek to destroy all that the Lyran people hold dear, the Clans have been positioned as despoilers of peace and monsters that must be resisted at all costs; images from across the frontlines and recaptured territories used to support these claims. A dramatic evolution of the Lyran state's previous propaganda—which presented the Clans as a dangerous but relatively conventional foe—the change in tack has reportedly led to mass signups by Lyran citizens and a burst of war bond sales larger than any that came before it. Reminiscent of similar messages made for American audiences during Earth's Second World War, some within the Republic and beyond have begun to wonder—and hope—that a similar story will play out in the current age: The Clans having hopefully awoken a sleeping giant.


    Draconis Combine
    Coming just in time considering the recent relaunch of the Clan Invasion, late December 3050 saw the Draconis Combine open an astounding eight 500,000-ton slipways—four built across Luthien, two in Avon despite its neutral status, and two hastily finished in Asgard after delays imposed by the previous invasion by Clan Jade Falcon. Valuable to both Combine and Clans alike, the construction facilities had made it through the conflicts that tore through the repressive state more or less intact, and heroic efforts were made to complete them upon their recapture by House Kurita. Doubtlessly recognising that warships are a must for the nation's continued survival in the face of the Clan assault, reports made by ComStar's news service indicate that the Combine has begun a colossal shipbuilding program, all eight slipways roaring with the sounds of industry.


    Operation Santiago (Clan Invasion Response)
    Note: The Naval and Ground Capacities will improve as the Clans approach, so keep that in mind as you're making plans.

    Note: Thanks to the Parthian-class Mobile Shipyard, ships can now make semi-major repairs in the field (this is intentionally left vague because I'm not simulating each ship)

    Helghan Contingent Capellan Contingent Taurian Contingent Magistracy Contingent Aurigan Contingent Lyran Deployments Combine Deployments
    • Naval Support Capacity: 18/18 [Base: 6] (use the naval upkeep values)
      Ground Support Capacity: 3.95/4.0 [Base: 0.75] (use the transport size value)
      Navy (18/18 Naval Support Capacity)
      • 14 Noctis Frigates (14 capacity)
      • 1 Pilum Battlecruiser (2 Capacity)
      • 2 Hecatoncheires Escort Carriers (2 capacity)
      • 42 Commissar-B Pocket Warships (0 capacity)
      Ground (3.95/4.0 Ground Support Capacity)
      • First Division, First Army (0.5 weight)
      • Second Division, First Army (0.5 weight)
      • Third Division, First Army (0.5 weight)
      • Fourth Division, First Army (0.5 weight)
      • 2 veteran BattleMech regiments (0.2 weight)
      • 1 regular BattleMech regiment (0.1 weight)
      • Cyborg special operations brigade (0.05 weight).
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Dreadnought)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Huliaipole)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Cerberus)
      • 1 MAWLR-II (0.4 weight) [100% health] (Name: Beats Walking)
      • 3 Forge Packs (0.0 Weight)
    • Navy
      • 4 Carson II-class Frigate (4 Capacity)
      Ground
      • 1 Mech Regiment (Death Commandos)
      • 1 Mech Regiment (Warrior House Daidachi)
      • 2 Mech Regiments (CCAF)
      • 6 Armoured Regiments
      • 8 Infantry Regiments
    • Navy
      • 4 Auroch-class Frigate (4 Capacity)
      Ground
      • 4 Combined Arms Brigades
    • Navy
      • 1 Canopus class Frigate (1 Capacity) [MCS Luxen]
      Ground
      • 4 Mech Regiments
      • 7 Armoured Regiments
      • 14 Infantry Regiments
    • Navy
      • 2 Halcon-class Destroyer (3 Capacity)
      Ground
      • 1 Mech Regiment
      • 3 Armoured Regiments
      • 4 Infantry Regiments
      • 3 Superheavy Gunships
    • Navy
      • 2 Nocti
      • 2 Toxotai
      Ground
      • Fifth Division, First Army
      • Sixth Division, First Army
      • 3x MAWLR-IIs
    • Navy
      • 4 Nocti
      Ground
      • N/A


    Q4 Casualty Estimates
    CasualtiesTotalKilledInjured
    Helghan Republic Armed Forces000
    Aurigan Coalition Military000
    Taurian Defence Force000
    Magistracy Armed Forces000
    Capellan Confederation000
    Clan Invaders (Est.)000
    Civilians (Est.)000

    Casualties To Date
    CasualtiesTotalKilledInjuredMissing
    Helghan Republic Armed Forces5,3571,4403,344573
    Aurigan Coalition Military2,5646311,87162
    Taurian Defence Force3,74311082,492143
    Magistracy Armed Forces3,65510042,493158
    Capellan Confederation4,6611,3093,244108
    Clan Invaders (Est.)11,1004,600+6,500+--
    Civilians (Est.)115,60036,400+79,200+--


    Map of the Inner Sphere (End of December, 3050)

    Link to bigger image here.
     
    Last edited:
  • View discussion
    • View content
    You must login or register to reply here.
    Remove ads
    Back
    Top